Hamburger Menu Button
Thermo Fisher Scientific Logo
登入
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Tubes
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Clinical Genomics
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO 和 CRO 服務
    • CDMO 服務
    • 臨床試驗 CRO 服務
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Register for an Account
    • How to Order
    • Instrument Support
    • Technical Support Centers
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • 快速訂購
          • 登入
            登入
            Don't have an account ? Create Account
            • 帳戶
            • 訂單
            • 訂製產品與專案
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8709053_10
          See other SOD2 GT Assays ›
          SNP ID:
          rs4880
          Gene
          SOD2
          Gene Name
          superoxide dismutase 2, mitochondrial
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.6: 159692840 - 159692840 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CTGCCTGGAGCCCAGATACCCCAAA[A/G]CCGGAGCCAGCTGCCTGCTGGTGCT

          Assay ID C___8709053_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 147460

          Literature Links:

          SOD2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.41)
          (0.59)
          Caucasian
          G (0.46)
          (0.54)
          CEPH (CEU)
          C (0.45)
          (0.55)
          EAS
          C (0.13)
          (0.87)
          African American
          G (0.44)
          (0.56)
          YRI (Yoruba)
          C (0.38)
          (0.62)
          SAS
          T (0.49)
          (0.51)
          Chinese - Not Available JPT (Japanese)
          C (0.11)
          (0.89)
          AFR
          C (0.42)
          (0.58)
          Japanese - Not Available CHB (Han Chinese)
          C (0.12)
          (0.88)
          EUR
          C (0.47)
          (0.53)
          AMR
          T (0.42)
          (0.58)
          SOD2 - superoxide dismutase 2, mitochondrial
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000636.3 208 Missense Mutation GCT,GTT A,V 16 NP_000627.2
          NM_001024465.2 208 Missense Mutation GCT,GTT A,V 16 NP_001019636.1
          NM_001024466.2 208 Missense Mutation GCT,GTT A,V 16 NP_001019637.1
          NM_001322814.1 208 Missense Mutation GCT,GTT A,V 16 NP_001309743.1
          NM_001322815.1 208 Missense Mutation GCT,GTT A,V 16 NP_001309744.1
          NM_001322816.1 208 Missense Mutation GCT,GTT A,V 16 NP_001309745.1
          NM_001322817.1 208 UTR 5 NP_001309746.1
          NM_001322819.1 208 UTR 5 NP_001309748.1
          NM_001322820.1 208 UTR 5 NP_001309749.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          oxidoreductase metabolite interconversion enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          response to reactive oxygen species
          response to superoxide
          age-dependent response to reactive oxygen species
          release of cytochrome c from mitochondria
          vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure
          regulation of transcription from RNA polymerase II promoter
          superoxide metabolic process
          regulation of blood pressure
          negative regulation of cell proliferation
          removal of superoxide radicals
          oxygen homeostasis
          negative regulation of neuron apoptotic process
          protein homotetramerization
          oxidation-reduction process
          negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway
          superoxide dismutase activity
          manganese ion binding
          identical protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Hong Kong flag icon
          Hong Kong

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-ctdjb:80/100.66.76.55:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0