Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8716062_10
          See other VDR GT Assays ›
          SNP ID:
          rs1544410
          Gene
          VDR
          Gene Name
          vitamin D (1,25- dihydroxyvitamin D3) receptor
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.12: 48239835 - 48239835 on Build 37
          Polymorphism:
          C/T, Transition Substitution
          Context Sequence [VIC/FAM]:

          GAGCAGAGCCTGAGTATTGGGAATG[C/T]GCAGGCCTGTCTGTGGCCCCAGGAA

          Assay ID C___8716062_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          42 submissions

          Phenotype:

          MIM: 601769

          Literature Links:

          VDR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU)
          A (0.44)
          (0.56)
          EAS - Not Available African American - Not Available YRI (Yoruba)
          A (0.28)
          (0.72)
          SAS - Not Available Japanese
          T (0.06)
          (0.94)
          JPT (Japanese)
          A (0.12)
          (0.88)
          AFR - Not Available Chinese
          T (0.03)
          (0.97)
          CHB (Han Chinese)
          A (0.02)
          (0.98)
          EUR - Not Available
          AMR - Not Available
          VDR - vitamin D (1,25- dihydroxyvitamin D3) receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000376.2 Intron NP_000367.1
          NM_001017535.1 Intron NP_001017535.1
          NM_001017536.1 Intron NP_001017536.1

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP rs11574109 is located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the NCBI SNP database (dbSNP). A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Set Membership:

          HapMap Validated

          Panther Classification:

          Biological Process -

          Nucleoside, nucleotide and nucleic acid metabolism mRNA transcription mRNA transcription regulation Signal transduction Cell communication Steroid hormone-mediated signaling Homeostasis Developmental processes Mesoderm development Skeletal development

          Molecular Function -

          Receptor Transcription factor Nuclear hormone receptor Nucleic acid binding

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          cellular morphogenesis
          transcription initiation from RNA polymerase II promoter
          signal transduction
          negative regulation of cell proliferation
          gene expression
          positive regulation of gene expression
          negative regulation of keratinocyte proliferation
          positive regulation of vitamin D 24-hydroxylase activity
          bile acid signaling pathway
          positive regulation of keratinocyte differentiation
          negative regulation of transcription, DNA-dependent
          positive regulation of transcription from RNA polymerase II promoter
          decidualization
          regulation of calcidiol 1-monooxygenase activity
          vitamin D receptor signaling pathway
          DNA binding
          transcription factor activity
          steroid hormone receptor activity
          protein binding
          zinc ion binding
          vitamin D3 receptor activity
          lithocholic acid receptor activity
          sequence-specific DNA binding
          retinoid X receptor binding
          vitamin D response element binding
          calcitriol binding
          lithocholic acid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline