Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGACGCGCGCTGTCGCCGCCCAC[G/T]AGTTCCCCGGGCTGCGCGCGCCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608172 MIM: 163910 | ||||||||||||||||||||
Literature Links: |
DHDDS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DHDDS - dehydrodolichyl diphosphate synthase subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMGN2 - high mobility group nucleosomal binding domain 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005517.3 | Intron | NP_005508.1 |
LOC101928324 - uncharacterized LOC101928324 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |