Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8876467_10
          See other TAS2R38 GT Assays ›
          SNP ID:
          rs713598
          Gene
          TAS2R38
          Gene Name
          taste 2 receptor member 38
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.7: 141973545 - 141973545 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AGCACACAATCACTGTTGCTCAGTG[C/G]CTGCCTCTTCACTACATCCCAAAAA

          Assay ID C___8876467_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 607751

          Literature Links:

          TAS2R38 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.50)
          (0.50)
          Caucasian
          G (0.38)
          (0.62)
          CEPH (CEU)
          G (0.43)
          (0.57)
          EAS
          C (0.32)
          (0.68)
          African American
          G (0.45)
          (0.55)
          YRI (Yoruba)
          G (0.39)
          (0.61)
          SAS
          C (0.35)
          (0.65)
          Chinese - Not Available JPT (Japanese)
          C (0.47)
          (0.53)
          AFR
          C (0.48)
          (0.52)
          Japanese - Not Available CHB (Han Chinese)
          G (0.32)
          (0.68)
          EUR
          G (0.42)
          (0.58)
          AMR
          C (0.34)
          (0.66)
          TAS2R38 - taste 2 receptor member 38
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_176817.4 229 Missense Mutation CCA,GCA P,A 49 NP_789787.4

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          detection of chemical stimulus involved in sensory perception of bitter taste
          G-protein coupled receptor signaling pathway
          G-protein coupled receptor activity
          bitter taste receptor activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-65nqn:80/100.66.78.26:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline