Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8932056_10
          See other IL13 GT Assays ›
          SNP ID:
          rs1800925
          Gene
          IL13 TH2LCRR
          Gene Name
          interleukin 13
          T helper type 2 locus control region associated RNA
          Set Membership:
          > Validated
          Chromosome Location:
          Chr.5: 132657117 - 132657117 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GGTTTCTGGAGGACTTCTAGGAAAA[C/T]GAGGGAAGAGCAGGAAAAGGCGACA

          Assay ID C___8932056_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 147683

          Literature Links:

          IL13 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.25)
          (0.75)
          Caucasian
          T (0.19)
          (0.81)
          CEPH (CEU) - Not Available
          EAS
          T (0.18)
          (0.82)
          African American
          T (0.33)
          (0.67)
          YRI (Yoruba) - Not Available
          SAS
          T (0.20)
          (0.80)
          Japanese
          T (0.18)
          (0.82)
          CHB (Han Chinese) - Not Available
          AFR
          T (0.42)
          (0.58)
          Chinese
          T (0.21)
          (0.79)
          JPT (Japanese) - Not Available
          EUR
          T (0.18)
          (0.82)
          AMR
          T (0.23)
          (0.77)
          IL13 - interleukin 13
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_002188.2 Intron NP_002179.2
          TH2LCRR - T helper type 2 locus control region associated RNA
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          microglial cell activation
          positive regulation of immunoglobulin production
          movement of cell or subcellular component
          inflammatory response
          immune response
          signal transduction
          cell-cell signaling
          regulation of proton transport
          positive regulation of B cell proliferation
          response to lipopolysaccharide
          positive regulation of connective tissue growth factor production
          negative regulation of NAD(P)H oxidase activity
          response to nicotine
          positive regulation of tyrosine phosphorylation of Stat6 protein
          positive regulation of macrophage activation
          positive regulation of mast cell degranulation
          response to ethanol
          positive regulation of smooth muscle cell proliferation
          positive regulation of protein secretion
          positive regulation of release of sequestered calcium ion into cytosol
          cellular response to mechanical stimulus
          cellular response to cytokine stimulus
          negative regulation of transforming growth factor beta production
          negative regulation of neuron death
          negative regulation of lung ciliated cell differentiation
          positive regulation of lung goblet cell differentiation
          negative regulation of complement-dependent cytotoxicity
          positive regulation of pancreatic stellate cell proliferation
          negative regulation of endothelial cell apoptotic process
          cytokine activity
          interleukin-13 receptor binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline