Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8932056_10
          See other IL13 GT Assays ›
          SNP ID:
          rs1800925
          Gene
          IL13 TH2LCRR
          Gene Name
          interleukin 13
          T helper type 2 locus control region associated RNA
          Set Membership:
          > Validated
          Chromosome Location:
          Chr.5: 132657117 - 132657117 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GGTTTCTGGAGGACTTCTAGGAAAA[C/T]GAGGGAAGAGCAGGAAAAGGCGACA

          Assay ID C___8932056_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 147683

          Literature Links:

          IL13 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.25)
          (0.75)
          Caucasian
          T (0.19)
          (0.81)
          CEPH (CEU) - Not Available
          EAS
          T (0.18)
          (0.82)
          African American
          T (0.33)
          (0.67)
          YRI (Yoruba) - Not Available
          SAS
          T (0.20)
          (0.80)
          Japanese
          T (0.18)
          (0.82)
          CHB (Han Chinese) - Not Available
          AFR
          T (0.42)
          (0.58)
          Chinese
          T (0.21)
          (0.79)
          JPT (Japanese) - Not Available
          EUR
          T (0.18)
          (0.82)
          AMR
          T (0.23)
          (0.77)
          IL13 - interleukin 13
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_002188.2 Intron NP_002179.2
          TH2LCRR - T helper type 2 locus control region associated RNA
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          microglial cell activation
          positive regulation of immunoglobulin production
          movement of cell or subcellular component
          inflammatory response
          immune response
          signal transduction
          cell-cell signaling
          regulation of proton transport
          positive regulation of B cell proliferation
          response to lipopolysaccharide
          positive regulation of connective tissue growth factor production
          negative regulation of NAD(P)H oxidase activity
          response to nicotine
          positive regulation of tyrosine phosphorylation of Stat6 protein
          positive regulation of macrophage activation
          positive regulation of mast cell degranulation
          response to ethanol
          positive regulation of smooth muscle cell proliferation
          positive regulation of protein secretion
          positive regulation of release of sequestered calcium ion into cytosol
          cellular response to mechanical stimulus
          cellular response to cytokine stimulus
          negative regulation of transforming growth factor beta production
          negative regulation of neuron death
          negative regulation of lung ciliated cell differentiation
          positive regulation of lung goblet cell differentiation
          negative regulation of complement-dependent cytotoxicity
          positive regulation of pancreatic stellate cell proliferation
          negative regulation of endothelial cell apoptotic process
          cytokine activity
          interleukin-13 receptor binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0