Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8966368_10
          See other IRAK1 GT Assays ›
          SNP ID:
          rs1059703
          Gene
          IRAK1 MECP2 MIR718
          Gene Name
          interleukin 1 receptor associated kinase 1
          methyl-CpG binding protein 2
          microRNA 718
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.X: 154013378 - 154013378 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AGGGGGGATGCAGCTGGCGGCCTCC[A/G]AATGCCCGGGCACCCCCGCCACCAC

          Assay ID C___8966368_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 300283 MIM: 300005 MIM: 300929

          Literature Links:

          IRAK1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.39)
          (0.61)
          Caucasian
          G (0.13)
          (0.87)
          CEPH (CEU)
          C (0.23)
          (0.77)
          EAS
          T (0.16)
          (0.84)
          African American
          G (0.30)
          (0.70)
          YRI (Yoruba)
          C (0.38)
          (0.62)
          SAS
          T (0.26)
          (0.74)
          Chinese - Not Available JPT (Japanese)
          T (0.21)
          (0.79)
          AFR
          T (0.46)
          (0.54)
          Japanese - Not Available CHB (Han Chinese)
          T (0.17)
          (0.83)
          EUR
          C (0.36)
          (0.64)
          AMR
          T (0.40)
          (0.60)
          IRAK1 - interleukin 1 receptor associated kinase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001025242.1 1437 Intron NP_001020413.1
          NM_001025243.1 1437 Missense Mutation TCG,TTG S,L 453 NP_001020414.1
          NM_001569.3 1437 Missense Mutation TCG,TTG S,L 532 NP_001560.2
          XM_005274668.3 1437 Intron XP_005274725.1
          XM_011531158.2 1437 Intron XP_011529460.1
          MECP2 - methyl-CpG binding protein 2
          There are no transcripts associated with this gene.
          MIR718 - microRNA 718
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          activation of MAPK activity
          regulation of cytokine-mediated signaling pathway
          toll-like receptor signaling pathway
          MyD88-dependent toll-like receptor signaling pathway
          protein phosphorylation
          signal transduction
          transmembrane receptor protein serine/threonine kinase signaling pathway
          activation of NF-kappaB-inducing kinase activity
          JNK cascade
          aging
          lipopolysaccharide-mediated signaling pathway
          negative regulation of NF-kappaB transcription factor activity
          positive regulation of type I interferon production
          response to lipopolysaccharide
          toll-like receptor 2 signaling pathway
          toll-like receptor 4 signaling pathway
          toll-like receptor 9 signaling pathway
          cellular response to heat
          negative regulation of apoptotic process
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          positive regulation of MAP kinase activity
          innate immune response
          positive regulation of transcription, DNA-templated
          protein autophosphorylation
          positive regulation of smooth muscle cell proliferation
          positive regulation of NF-kappaB transcription factor activity
          protein oligomerization
          nucleotide-binding oligomerization domain containing signaling pathway
          interleukin-1-mediated signaling pathway
          response to interleukin-1
          cellular response to hypoxia
          protein kinase activity
          protein serine/threonine kinase activity
          NF-kappaB-inducing kinase activity
          protein binding
          ATP binding
          kinase activity
          heat shock protein binding
          protein homodimerization activity
          protein heterodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-zdkzh:80/100.66.76.145:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline