Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Instrument Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • Our Instagram
      Our Instagram
    • Our Facebook
      Our Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___9323035_1_
          See other KEAP1 GT Assays ›
          SNP ID:
          rs1048290
          Gene
          KEAP1
          Gene Name
          kelch like ECH associated protein 1
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.19: 10489766 - 10489766 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          CGTCAAAGCCCCCCACGGCATAAAG[C/G]AGACGATTGAGGACAGCCACGCCCA

          Assay ID C___9323035_1_
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 606016

          Literature Links:

          KEAP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.49)
          (0.51)
          Caucasian
          C (0.41)
          (0.59)
          CEPH (CEU)
          C (0.33)
          (0.67)
          EAS
          C (0.47)
          (0.53)
          African American
          G (0.30)
          (0.70)
          YRI (Yoruba)
          G (0.22)
          (0.78)
          SAS
          C (0.46)
          (0.54)
          Chinese - Not Available JPT (Japanese)
          C (0.48)
          (0.52)
          AFR
          C (0.25)
          (0.75)
          Japanese - Not Available CHB (Han Chinese)
          G (0.44)
          (0.56)
          EUR
          G (0.36)
          (0.64)
          AMR
          G (0.30)
          (0.70)
          KEAP1 - kelch like ECH associated protein 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_012289.3 1737 Silent Mutation CTC,CTG L,L 471 NP_036421.2
          NM_203500.1 1737 Silent Mutation CTC,CTG L,L 471 NP_987096.1
          XM_005260173.1 1737 Silent Mutation CTC,CTG L,L 471 XP_005260230.1
          XM_005260174.1 1737 Silent Mutation CTC,CTG L,L 471 XP_005260231.1
          XM_011528452.1 1737 Silent Mutation CTC,CTG L,L 471 XP_011526754.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          scaffold/adaptor protein

          Gene Ontology Categories:

          Function(s) Process(es)

          in utero embryonic development
          selenium compound metabolic process
          malate metabolic process
          transcription, DNA-templated
          flavonoid metabolic process
          response to metal ion
          proteasomal ubiquitin-independent protein catabolic process
          negative regulation of gene expression
          protein ubiquitination
          alkanesulfonate metabolic process
          positive regulation of proteasomal ubiquitin-dependent protein catabolic process
          response to immobilization stress
          protein ubiquitination involved in ubiquitin-dependent protein catabolic process
          cytoplasmic sequestering of transcription factor
          negative regulation of sequence-specific DNA binding transcription factor activity
          regulation of epidermal cell differentiation
          protein oligomerization
          cellular response to interleukin-4
          cellular response to organic cyclic compound
          response to thyroid hormone
          ubiquitin-protein transferase activity
          protein binding
          transcription factor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Find Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-5xfkf:80/100.66.78.86:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline