Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___9345347_10
          See other KLRC4-KLRK1 GT Assays ›
          SNP ID:
          rs1049174
          Gene
          KLRC4-KLRK1 KLRK1 LOC101928100
          Gene Name
          KLRC4-KLRK1 readthrough
          killer cell lectin like receptor K1
          uncharacterized LOC101928100
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.12: 10372766 - 10372766 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          TGTGGAGGGTGGGGTTGCACTCTCA[C/G]TGATCTGCTGGCCTTCTCTTCCTTC

          Assay ID C___9345347_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611817

          Literature Links:

          KLRC4-KLRK1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.49)
          (0.51)
          Caucasian
          G (0.31)
          (0.69)
          CEPH (CEU)
          C (0.29)
          (0.71)
          EAS
          C (0.45)
          (0.55)
          African American
          C (0.30)
          (0.70)
          YRI (Yoruba)
          G (0.34)
          (0.66)
          SAS
          C (0.45)
          (0.55)
          Japanese
          G (0.31)
          (0.69)
          JPT (Japanese)
          C (0.35)
          (0.65)
          AFR
          G (0.25)
          (0.75)
          Chinese
          G (0.47)
          (0.53)
          CHB (Han Chinese)
          C (0.39)
          (0.61)
          EUR
          C (0.31)
          (0.69)
          AMR
          C (0.35)
          (0.65)
          KLRC4-KLRK1 - KLRC4-KLRK1 readthrough
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001199805.1 1176 UTR 3 NP_001186734.1
          KLRK1 - killer cell lectin like receptor K1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_007360.3 1176 UTR 3 NP_031386.2
          LOC101928100 - uncharacterized LOC101928100
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          stimulatory C-type lectin receptor signaling pathway
          adaptive immune response
          positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target
          signal transduction
          natural killer cell activation
          cell differentiation
          positive regulation of myeloid dendritic cell activation
          T cell costimulation
          positive regulation of interferon-gamma production
          negative regulation of GTPase activity
          positive regulation of apoptotic process
          innate immune response
          positive regulation of nitric oxide biosynthetic process
          positive regulation of natural killer cell mediated cytotoxicity
          regulation of immune response
          defense response to Gram-positive bacterium
          cellular response to lipopolysaccharide
          negative regulation of natural killer cell chemotaxis
          receptor activity
          protein binding
          kinase binding
          carbohydrate binding
          MHC class Ib receptor activity
          MHC class I protein binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-2lcrw:80/100.66.78.62:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0