Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___9345347_10
          See other KLRC4-KLRK1 GT Assays ›
          SNP ID:
          rs1049174
          Gene
          KLRC4-KLRK1 KLRK1 LOC101928100
          Gene Name
          KLRC4-KLRK1 readthrough
          killer cell lectin like receptor K1
          uncharacterized LOC101928100
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.12: 10372766 - 10372766 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          TGTGGAGGGTGGGGTTGCACTCTCA[C/G]TGATCTGCTGGCCTTCTCTTCCTTC

          Assay ID C___9345347_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611817

          Literature Links:

          KLRC4-KLRK1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.49)
          (0.51)
          Caucasian
          G (0.31)
          (0.69)
          CEPH (CEU)
          C (0.29)
          (0.71)
          EAS
          C (0.45)
          (0.55)
          African American
          C (0.30)
          (0.70)
          YRI (Yoruba)
          G (0.34)
          (0.66)
          SAS
          C (0.45)
          (0.55)
          Japanese
          G (0.31)
          (0.69)
          JPT (Japanese)
          C (0.35)
          (0.65)
          AFR
          G (0.25)
          (0.75)
          Chinese
          G (0.47)
          (0.53)
          CHB (Han Chinese)
          C (0.39)
          (0.61)
          EUR
          C (0.31)
          (0.69)
          AMR
          C (0.35)
          (0.65)
          KLRC4-KLRK1 - KLRC4-KLRK1 readthrough
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001199805.1 1176 UTR 3 NP_001186734.1
          KLRK1 - killer cell lectin like receptor K1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_007360.3 1176 UTR 3 NP_031386.2
          LOC101928100 - uncharacterized LOC101928100
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          stimulatory C-type lectin receptor signaling pathway
          adaptive immune response
          positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target
          signal transduction
          natural killer cell activation
          cell differentiation
          positive regulation of myeloid dendritic cell activation
          T cell costimulation
          positive regulation of interferon-gamma production
          negative regulation of GTPase activity
          positive regulation of apoptotic process
          innate immune response
          positive regulation of nitric oxide biosynthetic process
          positive regulation of natural killer cell mediated cytotoxicity
          regulation of immune response
          defense response to Gram-positive bacterium
          cellular response to lipopolysaccharide
          negative regulation of natural killer cell chemotaxis
          receptor activity
          protein binding
          kinase binding
          carbohydrate binding
          MHC class Ib receptor activity
          MHC class I protein binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline