Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___9546517_10
          See other IL1B GT Assays ›
          SNP ID:
          rs1143634
          Gene
          IL1B
          Gene Name
          interleukin 1 beta
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.2: 112832813 - 112832813 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          CATAAGCCTCGTTATCCCATGTGTC[G/A]AAGAAGATAGGTTCTGAAATGTGGA

          Assay ID C___9546517_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 147720

          Literature Links:

          IL1B PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.13)
          (0.87)
          Caucasian
          A (0.19)
          (0.81)
          CEPH (CEU)
          T (0.21)
          (0.79)
          EAS
          T (0.02)
          (0.98)
          African American
          A (0.08)
          (0.92)
          YRI (Yoruba)
          T (0.09)
          (0.91)
          SAS
          T (0.15)
          (0.85)
          Japanese
          A (0.09)
          (0.91)
          JPT (Japanese)
          T (0.06)
          (0.94)
          AFR
          T (0.12)
          (0.88)
          Chinese
          A (0.00)
          (1.00)
          CHB (Han Chinese)
          T (0.01)
          (0.99)
          EUR
          T (0.25)
          (0.75)
          AMR
          T (0.13)
          (0.87)
          IL1B - interleukin 1 beta
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000576.2 402 Silent Mutation TTC,TTT F,F 105 NP_000567.1
          XM_017003988.1 402 Silent Mutation TTC,TTT F,F 74 XP_016859477.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          interleukin superfamily

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          MAPK cascade
          activation of MAPK activity
          fever generation
          response to hypoxia
          positive regulation of protein phosphorylation
          chronic inflammatory response to antigenic stimulus
          positive regulation of T cell mediated immunity
          purine nucleobase metabolic process
          apoptotic process
          inflammatory response
          signal transduction
          positive regulation of cytosolic calcium ion concentration
          cell-cell signaling
          embryo implantation
          aging
          memory
          estrogen metabolic process
          negative regulation of cell proliferation
          glycoprotein metabolic process
          response to heat
          response to ozone
          response to gamma radiation
          positive regulation of vascular endothelial growth factor production
          positive regulation of gene expression
          negative regulation of glucose transport
          negative regulation of glutamate secretion
          smooth muscle adaptation
          cytokine-mediated signaling pathway
          pentacyclic triterpenoid metabolic process
          hyaluronan biosynthetic process
          neutrophil chemotaxis
          polyketide metabolic process
          ovulation
          sequestering of triglyceride
          positive regulation of vascular endothelial growth factor receptor signaling pathway
          positive regulation of fever generation
          lipopolysaccharide-mediated signaling pathway
          positive regulation of prostaglandin secretion
          response to estradiol
          interleukin-1 beta production
          positive regulation of granulocyte macrophage colony-stimulating factor production
          positive regulation of interferon-gamma production
          positive regulation of interleukin-6 production
          positive regulation of interleukin-8 production
          positive regulation of immature T cell proliferation in thymus
          positive regulation of histone phosphorylation
          response to ATP
          response to vitamin D
          response to L-ascorbic acid
          positive regulation of heterotypic cell-cell adhesion
          positive regulation of histone acetylation
          social behavior
          ectopic germ cell programmed cell death
          positive regulation of myosin light chain kinase activity
          response to stilbenoid
          cellular response to drug
          response to diuretic
          response to statin
          wound healing
          positive regulation of T cell proliferation
          positive regulation of NF-kappaB import into nucleus
          positive regulation of apoptotic process
          regulation of I-kappaB kinase/NF-kappaB signaling
          response to morphine
          negative regulation of MAP kinase activity
          response to peptide hormone
          protein kinase B signaling
          positive regulation of JUN kinase activity
          positive regulation of chemokine biosynthetic process
          positive regulation of interleukin-2 biosynthetic process
          positive regulation of interleukin-6 biosynthetic process
          positive regulation of nitric oxide biosynthetic process
          response to ethanol
          negative regulation of neuron differentiation
          positive regulation of angiogenesis
          negative regulation of lipid metabolic process
          positive regulation of mitotic nuclear division
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of JNK cascade
          negative regulation of insulin receptor signaling pathway
          positive regulation of protein export from nucleus
          positive regulation of astrocyte differentiation
          positive regulation of phagocytosis
          regulation of insulin secretion
          negative regulation of lipid catabolic process
          positive regulation of lipid catabolic process
          regulation of nitric-oxide synthase activity
          positive regulation of membrane protein ectodomain proteolysis
          positive regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of NF-kappaB transcription factor activity
          positive regulation of cell division
          positive regulation of cell adhesion molecule production
          positive regulation of calcidiol 1-monooxygenase activity
          negative regulation of adiponectin secretion
          positive regulation of ERK1 and ERK2 cascade
          monocyte aggregation
          cellular response to antibiotic
          cellular response to mechanical stimulus
          cellular response to organic substance
          cellular response to glucose stimulus
          cellular response to fatty acid
          cellular response to organic cyclic compound
          cellular response to methotrexate
          response to dexamethasone
          positive regulation of monocyte chemotactic protein-1 production
          positive regulation of neutrophil chemotaxis
          extrinsic apoptotic signaling pathway in absence of ligand
          regulation of establishment of endothelial barrier
          negative regulation of branching morphogenesis of a nerve
          negative regulation of neural precursor cell proliferation
          positive regulation of interleukin-6 secretion
          negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
          cytokine activity
          interleukin-1 receptor binding
          protein domain specific binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline