Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____203981_10
          See other FOXP1 GT Assays ›
          SNP ID:
          rs9878602
          Gene
          FOXP1
          Gene Name
          forkhead box P1
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 71486187 - 71486187 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          AGGTGACTTATGCACTAACCTTCTC[G/T]CTTCTCAACATTAAAACCAGAATAA

          Assay ID C____203981_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605515

          Literature Links:

          FOXP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.31)
          (0.69)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          FOXP1 - forkhead box P1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001012505.1 Intron NP_001012523.1
          NM_001244808.1 Intron NP_001231737.1
          NM_001244810.1 Intron NP_001231739.1
          NM_001244812.1 Intron NP_001231741.1
          NM_001244813.1 Intron NP_001231742.1
          NM_001244814.1 Intron NP_001231743.1
          NM_001244815.1 Intron NP_001231744.1
          NM_001244816.1 Intron NP_001231745.1
          NM_032682.5 Intron NP_116071.2
          XM_005264735.3 Intron XP_005264792.1
          XM_005264736.3 Intron XP_005264793.1
          XM_005264737.4 Intron XP_005264794.1
          XM_005264742.3 Intron XP_005264799.1
          XM_006713102.2 Intron XP_006713165.1
          XM_006713103.2 Intron XP_006713166.1
          XM_006713104.2 Intron XP_006713167.1
          XM_011533584.2 Intron XP_011531886.1
          XM_011533585.2 Intron XP_011531887.1
          XM_011533588.2 Intron XP_011531890.1
          XM_017006165.1 Intron XP_016861654.1
          XM_017006166.1 Intron XP_016861655.1
          XM_017006167.1 Intron XP_016861656.1
          XM_017006168.1 Intron XP_016861657.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of B cell apoptotic process
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          positive regulation of endothelial cell migration
          osteoclast differentiation
          response to lipopolysaccharide
          regulation of tumor necrosis factor production
          chemokine (C-C motif) ligand 2 secretion
          osteoclast development
          macrophage activation
          monocyte activation
          endothelial cell activation
          regulation of monocyte differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of smooth muscle cell proliferation
          regulation of interleukin-1 beta secretion
          regulation of inflammatory response
          negative regulation of androgen receptor signaling pathway
          T follicular helper cell differentiation
          interleukin-21 secretion
          regulation of defense response to bacterium
          regulation of macrophage colony-stimulating factor production
          regulation of endothelial tube morphogenesis
          regulation of interleukin-12 secretion
          RNA polymerase II transcription factor activity, sequence-specific DNA binding
          protein binding
          sequence-specific DNA binding
          protein self-association
          metal ion binding
          androgen receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-686rb:80/100.66.79.31:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0