Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CCACTCACTCCGCCCCCACCACTGC[C/T]TGCACACTTTCAGTGATGCAGCACT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 609138 | |||||||||||||||||||||||
Literature Links: |
LOC100131635 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LOC100131635 - hCG1645011-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RTP2 - receptor transporter protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001004312.2 | Intron | NP_001004312.2 | ||||
XM_017006301.1 | Intron | XP_016861790.1 | ||||
XM_017006302.1 | Intron | XP_016861791.1 |