Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____380158_10
          See other NCBP1 GT Assays ›
          SNP ID:
          rs1962592
          Gene
          NCBP1 XPA
          Gene Name
          nuclear cap binding protein subunit 1
          XPA, DNA damage recognition and repair factor
          Set Membership:
          -
          Chromosome Location:
          Chr.9: 97679211 - 97679211 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          ATACACTGTAATACTTAAGGGTAAA[G/T]GGTGGTGATGTATACAACTTAGTCT

          Assay ID C____380158_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600469 MIM: 611153

          Literature Links:

          NCBP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.16)
          (0.84)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.06)
          (0.94)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.17)
          (0.83)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.22)
          (0.78)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.19)
          (0.81)
          AMR
          T (0.17)
          (0.83)
          NCBP1 - nuclear cap binding protein subunit 1
          There are no transcripts associated with this gene.
          XPA - XPA, DNA damage recognition and repair factor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000380.3 Intron NP_000371.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          damaged DNA-binding protein

          Gene Ontology Categories:

          Function(s) Process(es)

          nucleotide-excision repair, DNA damage recognition
          nucleotide-excision repair, DNA duplex unwinding
          DNA repair
          transcription-coupled nucleotide-excision repair
          base-excision repair
          nucleotide-excision repair, preincision complex stabilization
          nucleotide-excision repair, preincision complex assembly
          nucleotide-excision repair, DNA incision, 3'-to lesion
          nucleotide-excision repair, DNA incision, 5'-to lesion
          response to oxidative stress
          intrinsic apoptotic signaling pathway in response to DNA damage
          response to toxic substance
          response to auditory stimulus
          nucleotide-excision repair, DNA incision
          multicellular organism growth
          global genome nucleotide-excision repair
          UV-damage excision repair
          nucleotide-excision repair involved in interstrand cross-link repair
          damaged DNA binding
          protein binding
          protein domain specific binding
          protein homodimerization activity
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-wk68q:80/100.66.79.78:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline