Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Servicios para Empresas
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____463954_10
          See other CHD3 GT Assays ›
          SNP ID:
          rs12450454
          Gene
          CHD3 NAA38
          Gene Name
          chromodomain helicase DNA binding protein 3
          N(alpha)-acetyltransferase 38, NatC auxiliary subunit
          Set Membership:
          > Validated
          Chromosome Location:
          Chr.17: 7890884 - 7890884 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          GTGGGTAGGTAGACAGGCCTGTGTG[C/G]GGCCTGGAATAGGGGCTGGAGGAGC

          Assay ID C____463954_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602120

          Literature Links:

          CHD3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.28)
          (0.72)
          Caucasian
          G (0.44)
          (0.56)
          CEPH (CEU) - Not Available
          EAS
          C (0.03)
          (0.97)
          African American
          C (0.29)
          (0.71)
          YRI (Yoruba) - Not Available
          SAS
          C (0.33)
          (0.67)
          Japanese
          C (0.04)
          (0.96)
          CHB (Han Chinese) - Not Available
          AFR
          C (0.18)
          (0.82)
          Chinese
          C (0.07)
          (0.93)
          JPT (Japanese) - Not Available
          EUR
          G (0.41)
          (0.59)
          AMR
          C (0.31)
          (0.69)
          CHD3 - chromodomain helicase DNA binding protein 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001005271.2 Intron NP_001005271.2
          NM_001005273.2 Intron NP_001005273.1
          NM_005852.3 Intron NP_005843.2
          XM_005256427.4 Intron XP_005256484.1
          XM_005256428.4 Intron XP_005256485.1
          XM_005256429.4 Intron XP_005256486.1
          XM_005256431.4 Intron XP_005256488.1
          XM_006721423.3 Intron XP_006721486.1
          XM_006721424.3 Intron XP_006721487.1
          XM_006721428.3 Intron XP_006721491.1
          XM_017024061.1 Intron XP_016879550.1
          XM_017024062.1 Intron XP_016879551.1
          XM_017024063.1 Intron XP_016879552.1
          XM_017024064.1 Intron XP_016879553.1
          XM_017024065.1 Intron XP_016879554.1
          XM_017024066.1 Intron XP_016879555.1
          XM_017024067.1 Intron XP_016879556.1
          XM_017024068.1 Intron XP_016879557.1
          XM_017024069.1 Intron XP_016879558.1
          XM_017024070.1 Intron XP_016879559.1
          NAA38 - N(alpha)-acetyltransferase 38, NatC auxiliary subunit
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          chromatin assembly or disassembly
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          spindle organization
          histone deacetylation
          DNA duplex unwinding
          centrosome organization
          regulation of signal transduction by p53 class mediator
          DNA binding
          ATP-dependent DNA helicase activity
          helicase activity
          histone deacetylase activity
          protein binding
          ATP binding
          zinc ion binding
          poly(A) RNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-6vn4c:80/100.66.75.107:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0