Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____476634_10
          See other CNTROB GT Assays ›
          SNP ID:
          rs4239114
          Gene
          CNTROB KCNAB3 TRAPPC1
          Gene Name
          centrobin, centriole duplication and spindle assembly protein
          potassium voltage-gated channel subfamily A regulatory beta subunit 3
          trafficking protein particle complex 1
          Set Membership:
          > Validated
          Chromosome Location:
          Chr.17: 7933500 - 7933500 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TAACTGCATAGGCAGCCATGCTTAT[A/G]AGGGAGGGAGTGACCTGGGACACCA

          Assay ID C____476634_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611425 MIM: 604111 MIM: 610969

          Literature Links:

          CNTROB PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.33)
          (0.67)
          Caucasian
          A (0.48)
          (0.52)
          CEPH (CEU) - Not Available
          EAS
          A (0.05)
          (0.95)
          African American
          A (0.50)
          (0.50)
          YRI (Yoruba) - Not Available
          SAS
          A (0.24)
          (0.76)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.47)
          (0.53)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.46)
          (0.54)
          AMR
          A (0.31)
          (0.69)
          CNTROB - centrobin, centriole duplication and spindle assembly protein
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001037144.5 Intron NP_001032221.1
          NM_053051.3 Intron NP_444279.2
          XM_005256437.2 Intron XP_005256494.1
          XM_005256438.2 Intron XP_005256495.1
          XM_005256439.2 Intron XP_005256496.1
          XM_017024128.1 Intron XP_016879617.1
          XM_017024129.1 Intron XP_016879618.1
          XM_017024130.1 Intron XP_016879619.1
          XM_017024131.1 Intron XP_016879620.1
          XM_017024132.1 Intron XP_016879621.1
          XM_017024133.1 Intron XP_016879622.1
          XM_017024134.1 Intron XP_016879623.1
          XM_017024135.1 Intron XP_016879624.1
          XM_017024136.1 Intron XP_016879625.1
          XM_017024137.1 Intron XP_016879626.1
          XM_017024138.1 Intron XP_016879627.1
          XM_017024139.1 Intron XP_016879628.1
          XM_017024140.1 Intron XP_016879629.1
          XM_017024141.1 Intron XP_016879630.1
          XM_017024142.1 Intron XP_016879631.1
          XM_017024143.1 Intron XP_016879632.1
          XM_017024144.1 Intron XP_016879633.1
          KCNAB3 - potassium voltage-gated channel subfamily A regulatory beta subunit 3
          There are no transcripts associated with this gene.
          TRAPPC1 - trafficking protein particle complex 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          centriole replication
          centrosome separation
          mitotic cytokinetic process
          protein binding
          protein domain specific binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-ctdjb:80/100.66.76.55:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0