Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____496421_10
          See other ARID5B GT Assays ›
          SNP ID:
          rs10740055
          Gene
          ARID5B
          Gene Name
          AT-rich interaction domain 5B
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 61958720 - 61958720 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          CTAGGAACTTATACTTAGTTCAAAC[A/C]CAGCTTTCCAAATAGAAACCCTGTG

          Assay ID C____496421_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 608538

          Literature Links:

          ARID5B PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.44)
          (0.56)
          Caucasian - Not Available CEPH (CEU)
          C (0.47)
          (0.53)
          EAS
          A (0.45)
          (0.55)
          African American - Not Available YRI (Yoruba)
          C (0.50)
          (0.50)
          SAS
          A (0.30)
          (0.70)
          Chinese - Not Available JPT (Japanese)
          A (0.47)
          (0.53)
          AFR
          A (0.48)
          (0.52)
          Japanese - Not Available CHB (Han Chinese)
          A (0.48)
          (0.52)
          EUR
          C (0.50)
          (0.50)
          AMR
          A (0.43)
          (0.57)
          ARID5B - AT-rich interaction domain 5B
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001244638.1 Intron NP_001231567.1
          NM_032199.2 Intron NP_115575.1
          XM_011540262.1 Intron XP_011538564.1
          XM_017016765.1 Intron XP_016872254.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          transcription cofactor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          kidney development
          liver development
          transcription, DNA-templated
          male gonad development
          female gonad development
          post-embryonic development
          fibroblast migration
          histone demethylation
          adrenal gland development
          multicellular organism growth
          fat cell differentiation
          negative regulation of transcription, DNA-templated
          platelet-derived growth factor receptor signaling pathway
          cell development
          muscle organ morphogenesis
          skeletal system morphogenesis
          positive regulation of sequence-specific DNA binding transcription factor activity
          palate development
          face morphogenesis
          adipose tissue development
          fat pad development
          RNA polymerase II regulatory region sequence-specific DNA binding
          transcriptional repressor activity, RNA polymerase II transcription regulatory region sequence-specific binding
          DNA binding
          transcription coactivator activity
          protein binding
          histone demethylase activity
          transcription regulatory region DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-tr4x4:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline