Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____599131_10
          See other CEP250 GT Assays ›
          SNP ID:
          rs736031
          Gene
          CEP250 GDF5 MIR1289-1
          Gene Name
          centrosomal protein 250
          growth differentiation factor 5
          microRNA 1289-1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.20: 35460805 - 35460805 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          AGGGCACTGATTTGTCATCTCTGGC[C/T]TATGGCTTAGCTCTGCCAGGAGTGA

          Assay ID C____599131_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 609689 MIM: 601146

          Literature Links:

          CEP250 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.40)
          (0.60)
          Caucasian - Not Available CEPH (CEU)
          C (0.13)
          (0.87)
          EAS
          C (0.27)
          (0.73)
          African American - Not Available YRI (Yoruba)
          T (0.46)
          (0.54)
          SAS
          T (0.49)
          (0.51)
          Chinese - Not Available JPT (Japanese)
          C (0.21)
          (0.79)
          AFR
          T (0.39)
          (0.61)
          Japanese - Not Available CHB (Han Chinese)
          C (0.21)
          (0.79)
          EUR
          C (0.25)
          (0.75)
          AMR
          C (0.26)
          (0.74)
          CEP250 - centrosomal protein 250
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001318219.1 Intron NP_001305148.1
          NM_007186.5 Intron NP_009117.2
          XM_005260262.4 Intron XP_005260319.1
          XM_005260263.4 Intron XP_005260320.1
          XM_005260264.4 Intron XP_005260321.1
          XM_006723690.3 Intron XP_006723753.1
          XM_006723691.1 Intron XP_006723754.1
          XM_006723692.3 Intron XP_006723755.1
          XM_006723693.3 Intron XP_006723756.1
          XM_006723694.3 Intron XP_006723757.1
          XM_011528517.2 Intron XP_011526819.1
          XM_011528518.2 Intron XP_011526820.1
          XM_011528519.2 Intron XP_011526821.1
          XM_017027617.1 Intron XP_016883106.1
          XM_017027618.1 Intron XP_016883107.1
          XM_017027619.1 Intron XP_016883108.1
          GDF5 - growth differentiation factor 5
          There are no transcripts associated with this gene.
          MIR1289-1 - microRNA 1289-1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          chromatin/chromatin-binding, or -regulatory protein

          Gene Ontology Categories:

          Function(s) Process(es)

          G2/M transition of mitotic cell cycle
          mitotic cell cycle
          protein localization
          centriole-centriole cohesion
          regulation of centriole-centriole cohesion
          protein localization to organelle
          nonmotile primary cilium assembly
          protein binding
          protein C-terminus binding
          protein kinase binding
          protein domain specific binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline