Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____809945_10
          See other OPRM1 GT Assays ›
          SNP ID:
          rs675026
          Gene
          OPRM1
          Gene Name
          opioid receptor mu 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 154093428 - 154093428 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ATACTGCTCCCAGCCCGTCTGGTGG[A/G]GCATTTCTCCTGAGTTAAGCATGAT

          Assay ID C____809945_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600018

          Literature Links:

          OPRM1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.22)
          (0.78)
          Caucasian - Not Available CEPH (CEU)
          T (0.37)
          (0.63)
          EAS
          T (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba)
          T (0.22)
          (0.78)
          SAS
          T (0.15)
          (0.85)
          Chinese - Not Available JPT (Japanese)
          T (0.08)
          (0.92)
          AFR
          T (0.27)
          (0.73)
          Japanese - Not Available CHB (Han Chinese)
          T (0.06)
          (0.94)
          EUR
          T (0.33)
          (0.67)
          AMR
          T (0.27)
          (0.73)
          OPRM1 - opioid receptor mu 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000914.4 1216 Intron NP_000905.3
          NM_001008503.2 1216 Intron NP_001008503.2
          NM_001008504.3 1216 Intron NP_001008504.2
          NM_001008505.2 1216 Silent Mutation GGA,GGG G,G 441 NP_001008505.2
          NM_001145279.3 1216 Intron NP_001138751.1
          NM_001145280.3 1216 Intron NP_001138752.1
          NM_001145281.2 1216 Intron NP_001138753.1
          NM_001145282.2 1216 Intron NP_001138754.1
          NM_001145283.2 1216 Intron NP_001138755.1
          NM_001145284.3 1216 Intron NP_001138756.1
          NM_001145285.2 1216 Intron NP_001138757.1
          NM_001145286.2 1216 Intron NP_001138758.1
          NM_001145287.2 1216 Intron NP_001138759.1
          NM_001285522.1 1216 Intron NP_001272451.1
          NM_001285523.1 1216 Intron NP_001272452.1
          NM_001285524.1 1216 Intron NP_001272453.1
          NM_001285526.1 1216 Intron NP_001272455.1
          NM_001285527.1 1216 Intron NP_001272456.1
          NM_001285528.1 1216 Intron NP_001272457.1
          XM_011535851.2 1216 Silent Mutation GGA,GGG G,G 341 XP_011534153.1
          XM_011535853.2 1216 Silent Mutation GGA,GGG G,G 341 XP_011534155.1
          XM_011535856.2 1216 Silent Mutation GGA,GGG G,G 341 XP_011534158.1
          XM_011535862.2 1216 Silent Mutation GGA,GGG G,G 341 XP_011534164.1
          XM_017010903.1 1216 Silent Mutation GGA,GGG G,G 341 XP_016866392.1
          XM_017010904.1 1216 Silent Mutation GGA,GGG G,G 341 XP_016866393.1
          XM_017010905.1 1216 Silent Mutation GGA,GGG G,G 341 XP_016866394.1
          XM_017010906.1 1216 Intron XP_016866395.1
          XM_017010907.1 1216 Intron XP_016866396.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          acute inflammatory response to antigenic stimulus
          G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger
          adenylate cyclase-activating dopamine receptor signaling pathway
          negative regulation of adenylate cyclase activity
          phospholipase C-activating G-protein coupled receptor signaling pathway
          neuropeptide signaling pathway
          chemical synaptic transmission
          sensory perception
          locomotory behavior
          negative regulation of cell proliferation
          response to radiation
          sensory perception of pain
          adenylate cyclase-inhibiting opioid receptor signaling pathway
          response to food
          positive regulation of appetite
          response to lipopolysaccharide
          cellular response to stress
          wound healing
          response to cocaine
          eating behavior
          estrous cycle
          behavioral response to ethanol
          positive regulation of neurogenesis
          regulation of sensory perception of pain
          excitatory postsynaptic potential
          negative regulation of Wnt protein secretion
          positive regulation of ERK1 and ERK2 cascade
          calcium ion transmembrane transport
          response to growth factor
          cellular response to morphine
          regulation of N-methyl-D-aspartate selective glutamate receptor activity
          G-protein alpha-subunit binding
          G-protein coupled receptor activity
          beta-endorphin receptor activity
          voltage-gated calcium channel activity
          protein binding
          protein C-terminus binding
          protein domain specific binding
          filamin binding
          G-protein beta-subunit binding
          morphine receptor activity
          neuropeptide binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-j77tp:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline