Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____995540_10
          See other LOC103344931 GT Assays ›
          SNP ID:
          rs481419
          Gene
          LOC103344931 VTI1A
          Gene Name
          uncharacterized LOC103344931
          vesicle transport through interaction with t-SNAREs 1A
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 112825721 - 112825721 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GAGAACCCTCATGTCTAGGGAGCAC[C/T]CCATGGGGTCATCTCCATGCCTGAG

          Assay ID C____995540_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 614316

          Literature Links:

          LOC103344931 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.15)
          (0.85)
          Caucasian - Not Available CEPH (CEU)
          T (0.20)
          (0.80)
          EAS
          T (0.27)
          (0.73)
          African American - Not Available YRI (Yoruba)
          T (0.08)
          (0.92)
          SAS
          T (0.14)
          (0.86)
          Chinese - Not Available JPT (Japanese)
          T (0.34)
          (0.66)
          AFR
          T (0.04)
          (0.96)
          Japanese - Not Available CHB (Han Chinese)
          T (0.31)
          (0.69)
          EUR
          T (0.18)
          (0.82)
          AMR
          T (0.18)
          (0.82)
          LOC103344931 - uncharacterized LOC103344931
          There are no transcripts associated with this gene.
          VTI1A - vesicle transport through interaction with t-SNAREs 1A
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001318203.1 11410 Intron NP_001305132.1
          NM_001318205.1 11410 Intron NP_001305134.1
          NM_145206.3 11410 Intron NP_660207.2
          XM_005269544.4 11410 Intron XP_005269601.1
          XM_005269545.4 11410 Intron XP_005269602.1
          XM_005269546.3 11410 UTR 3 XP_005269603.1
          XM_005269547.4 11410 Intron XP_005269604.1
          XM_006717637.2 11410 Intron XP_006717700.1
          XM_011539328.2 11410 Intron XP_011537630.1
          XM_011539330.2 11410 Intron XP_011537632.1
          XM_011539331.2 11410 Intron XP_011537633.1
          XM_011539333.2 11410 Intron XP_011537635.1
          XM_017015745.1 11410 Intron XP_016871234.1
          XM_017015746.1 11410 Intron XP_016871235.1
          XM_017015747.1 11410 Intron XP_016871236.1
          XM_017015748.1 11410 Intron XP_016871237.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          SNARE protein

          Gene Ontology Categories:

          Function(s) Process(es)

          protein targeting to vacuole
          ER to Golgi vesicle-mediated transport
          intra-Golgi vesicle-mediated transport
          Golgi to vacuole transport
          autophagy
          retrograde transport, endosome to Golgi
          vesicle fusion with Golgi apparatus
          voluntary musculoskeletal movement
          Golgi ribbon formation
          SNARE binding
          SNAP receptor activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline