Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › M__22302236_10
          See other 4930557K07RIK GT Assays ›
          SNP ID:
          rs13479014
          Gene
          4930557K07Rik Acrbp Ing4
          Gene Name
          RIKEN cDNA 4930557K07 gene
          proacrosin binding protein
          inhibitor of growth family, member 4
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 125048587 - 125048587 on Build GRCm38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          ATCCAAACCCCAGTAGGGAGGGTGC[C/T]GCAGCCAGTGACGGTATGTGCTCTC

          Assay ID M__22302236_10
          Size
          Availability Made To Order
          Catalog # 4351384
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Mouse

          dbSNP Submissions:

          NA

          Phenotype:

          Literature Links:

          4930557K07Rik PubMed Links
          4930557K07Rik - RIKEN cDNA 4930557K07 gene
          There are no transcripts associated with this gene.
          Acrbp - proacrosin binding protein
          There are no transcripts associated with this gene.
          Ing4 - inhibitor of growth family, member 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_133345.2 940 UTR 3 NP_579923.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          chromatin/chromatin-binding, or -regulatory protein

          Gene Ontology Categories:

          Function(s) Process(es)

          DNA replication
          protein acetylation
          apoptotic process
          DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator
          cell cycle
          cell cycle arrest
          negative regulation of cell proliferation
          chromatin modification
          histone acetylation
          positive regulation of apoptotic process
          histone H3 acetylation
          histone H4-K5 acetylation
          histone H4-K8 acetylation
          histone H4-K12 acetylation
          negative regulation of transcription, DNA-templated
          negative regulation of growth
          transcription coactivator activity
          protein binding
          zinc ion binding
          methylated histone binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-gkxk9:80/100.66.77.77:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline