Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › M__22317590_10
          See other NOTCH1 GT Assays ›
          SNP ID:
          rs6227113
          Gene
          Notch1
          Gene Name
          notch 1
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 26482942 - 26482942 on Build GRCm38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GGGTGGACAATTTTCACTTCTCCCT[A/G]CTCTGAAACAGCATGTCTCCACACA

          Assay ID M__22317590_10
          Size
          Availability Made To Order
          Catalog # 4351384
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Mouse

          dbSNP Submissions:

          NA

          Phenotype:

          Literature Links:

          Notch1 PubMed Links
          Notch1 - notch 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_008714.3 Intron NP_032740.3

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          angiogenesis
          in utero embryonic development
          cell fate specification
          epithelial to mesenchymal transition
          liver development
          heart looping
          sprouting angiogenesis
          osteoblast fate commitment
          positive regulation of neuroblast proliferation
          inflammatory response to antigenic stimulus
          endocardium development
          endocardium morphogenesis
          atrioventricular node development
          coronary vein morphogenesis
          aortic valve morphogenesis
          atrioventricular valve morphogenesis
          pulmonary valve morphogenesis
          mitral valve formation
          epithelial to mesenchymal transition involved in endocardial cushion formation
          endocardial cushion morphogenesis
          cardiac chamber formation
          cardiac ventricle morphogenesis
          cardiac atrium morphogenesis
          cardiac right atrium morphogenesis
          cardiac left ventricle morphogenesis
          cardiac right ventricle formation
          ventricular trabecula myocardium morphogenesis
          growth involved in heart morphogenesis
          regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation
          regulation of cardioblast proliferation
          Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation
          cell migration involved in endocardial cushion formation
          pericardium morphogenesis
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          transcription from RNA polymerase II promoter
          humoral immune response
          Notch signaling pathway
          positive regulation of transcription of Notch receptor target
          multicellular organism development
          spermatogenesis
          determination of left/right symmetry
          compartment pattern specification
          axonogenesis
          foregut morphogenesis
          endoderm development
          heart development
          positive regulation of cell proliferation
          negative regulation of cell proliferation
          epidermis development
          regulation of Notch signaling pathway
          auditory receptor cell fate commitment
          glial cell differentiation
          regulation of gene expression
          positive regulation of epithelial to mesenchymal transition
          negative regulation of cell-substrate adhesion
          negative regulation of myotube differentiation
          mesenchymal cell development
          regulation of somitogenesis
          neural tube development
          cell differentiation
          neuron differentiation
          keratinocyte differentiation
          negative regulation of ossification
          lung development
          embryonic limb morphogenesis
          regulation of cell migration
          positive regulation of cell migration
          positive regulation of BMP signaling pathway
          negative regulation of BMP signaling pathway
          forebrain development
          hair follicle morphogenesis
          response to muramyl dipeptide
          embryonic hindlimb morphogenesis
          tube formation
          skeletal muscle cell differentiation
          cellular response to vascular endothelial growth factor stimulus
          regulation of cell proliferation
          anagen
          positive regulation of apoptotic process
          negative regulation of catalytic activity
          cell fate commitment
          negative regulation of cell differentiation
          positive regulation of endothelial cell differentiation
          regulation of auditory receptor cell differentiation
          negative regulation of auditory receptor cell differentiation
          positive regulation of keratinocyte differentiation
          negative regulation of myoblast differentiation
          negative regulation of neuron differentiation
          negative regulation of osteoblast differentiation
          positive regulation of glial cell differentiation
          positive regulation of Notch signaling pathway
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of calcium ion-dependent exocytosis
          positive regulation of JAK-STAT cascade
          negative regulation of photoreceptor cell differentiation
          somatic stem cell division
          neuron fate commitment
          astrocyte differentiation
          positive regulation of astrocyte differentiation
          negative regulation of oligodendrocyte differentiation
          branching morphogenesis of an epithelial tube
          regulation of epithelial cell proliferation
          positive regulation of epithelial cell proliferation
          regulation of neurogenesis
          negative regulation of neurogenesis
          regulation of developmental process
          cardiac muscle tissue morphogenesis
          cardiac muscle cell proliferation
          positive regulation of cardiac muscle cell proliferation
          negative regulation of glial cell proliferation
          cardiac epithelial to mesenchymal transition
          cardiac septum morphogenesis
          ventricular septum morphogenesis
          secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development
          negative regulation of cell death
          prostate gland epithelium morphogenesis
          regulation of epithelial cell proliferation involved in prostate gland development
          arterial endothelial cell differentiation
          venous endothelial cell differentiation
          cardiac vascular smooth muscle cell development
          endocardial cell differentiation
          vasculogenesis involved in coronary vascular morphogenesis
          coronary artery morphogenesis
          Notch signaling involved in heart development
          regulation of cell adhesion involved in heart morphogenesis
          heart trabecula morphogenesis
          positive regulation of transcription from RNA polymerase II promoter in response to hypoxia
          left/right axis specification
          cellular response to follicle-stimulating hormone stimulus
          interleukin-4 secretion
          negative regulation of cell migration involved in sprouting angiogenesis
          negative regulation of canonical Wnt signaling pathway
          positive regulation of ephrin receptor signaling pathway
          regulation of extracellular matrix assembly
          apoptotic process involved in embryonic digit morphogenesis
          negative regulation of stem cell differentiation
          negative regulation of anoikis
          negative regulation of pro-B cell differentiation
          negative regulation of endothelial cell chemotaxis
          core promoter binding
          transcriptional activator activity, RNA polymerase II transcription factor binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          enzyme inhibitor activity
          receptor activity
          Notch binding
          calcium ion binding
          protein binding
          enzyme binding
          chromatin DNA binding
          sequence-specific DNA binding
          metal ion binding
          protein heterodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0