Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › M__24196588_10
          See other HIF1A GT Assays ›
          SNP ID:
          rs8259450
          Gene
          Hif1a
          Gene Name
          hypoxia inducible factor 1, alpha subunit
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 73942092 - 73942092 on Build GRCm38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GCCCTCCAAGTATGAGCACAGTTAC[C/T]GGGTTCCAGCAGACCCAGTTACAGA

          Assay ID M__24196588_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351384
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Mouse

          dbSNP Submissions:

          NA

          Phenotype:

          Literature Links:

          Hif1a PubMed Links
          Hif1a - hypoxia inducible factor 1, alpha subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_010431.2 2253 Silent Mutation NP_034561.2

          Back To Top

          추가 정보


          Panther Classification:

          Molecular Function -

          basic helix-loop-helix transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          angiogenesis
          blood vessel development
          response to hypoxia
          neural crest cell migration
          epithelial to mesenchymal transition
          embryonic placenta development
          B-1 B cell homeostasis
          vasculature development
          heart looping
          positive regulation of neuroblast proliferation
          connective tissue replacement involved in inflammatory response wound healing
          outflow tract morphogenesis
          cardiac ventricle morphogenesis
          lactate metabolic process
          regulation of glycolytic process
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          transcription from RNA polymerase II promoter
          cellular iron ion homeostasis
          signal transduction
          lactation
          positive regulation of cell proliferation
          visual learning
          regulation of gene expression
          positive regulation of autophagy
          vascular endothelial growth factor production
          positive regulation of vascular endothelial growth factor production
          positive regulation of gene expression
          positive regulation of epithelial cell migration
          positive regulation of receptor biosynthetic process
          response to muscle activity
          axonal transport of mitochondrion
          neural fold elevation formation
          cerebral cortex development
          cell differentiation
          negative regulation of bone mineralization
          positive regulation of vascular endothelial growth factor receptor signaling pathway
          negative regulation of TOR signaling
          oxygen homeostasis
          regulation of transforming growth factor beta2 production
          collagen metabolic process
          negative regulation of transcription elongation from RNA polymerase II promoter
          embryonic hemopoiesis
          positive regulation of insulin secretion involved in cellular response to glucose stimulus
          regulation of cell proliferation
          hemoglobin biosynthetic process
          glucose homeostasis
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          negative regulation of neuron apoptotic process
          regulation of transcription from RNA polymerase II promoter in response to oxidative stress
          positive regulation of erythrocyte differentiation
          positive regulation of transcription, DNA-templated
          negative regulation of vasoconstriction
          negative regulation of growth
          positive regulation of transcription from RNA polymerase II promoter
          muscle cell cellular homeostasis
          positive regulation of hormone biosynthetic process
          blood vessel morphogenesis
          digestive tract morphogenesis
          positive regulation of smooth muscle cell proliferation
          regulation of catalytic activity
          cartilage development
          elastin metabolic process
          intestinal epithelial cell maturation
          response to fungicide
          epithelial cell differentiation involved in mammary gland alveolus development
          retina vasculature development in camera-type eye
          positive regulation of transcription from RNA polymerase II promoter in response to hypoxia
          regulation of thymocyte apoptotic process
          negative regulation of thymocyte apoptotic process
          cellular response to hypoxia
          dopaminergic neuron differentiation
          hypoxia-inducible factor-1alpha signaling pathway
          negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway
          positive regulation of mitophagy
          regulation of aerobic respiration
          negative regulation of reactive oxygen species metabolic process
          negative regulation of mesenchymal cell apoptotic process
          RNA polymerase II transcription factor activity, sequence-specific DNA binding
          transcription factor activity, transcription factor binding
          transcription factor activity, RNA polymerase II transcription factor binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          transcription factor activity, RNA polymerase II distal enhancer sequence-specific binding
          signal transducer activity
          protein binding
          transcription factor binding
          enzyme binding
          protein kinase binding
          ubiquitin protein ligase binding
          protein complex binding
          histone acetyltransferase binding
          nuclear hormone receptor binding
          histone deacetylase binding
          sequence-specific DNA binding
          protein heterodimerization activity
          protein dimerization activity
          Hsp90 protein binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-d59m7:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0