Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › M__25376638_10
          See other G3BP1 GT Assays ›
          SNP ID:
          rs29405909
          Gene
          G3bp1 Gm12238
          Gene Name
          GTPase activating protein (SH3 domain) binding protein 1
          predicted gene 12238
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 55483148 - 55483148 on Build GRCm38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TGCTTCACTATGCACCACTGCCGCC[A/G]CCTCCCTCCCATATTTTAAACAGGG

          Assay ID M__25376638_10
          Size
          Availability Made To Order
          Catalog # 4351384
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Mouse

          dbSNP Submissions:

          NA

          Phenotype:

          Literature Links:

          G3bp1 PubMed Links
          G3bp1 - GTPase activating protein (SH3 domain) binding protein 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_013716.2 Intron NP_038744.1
          Gm12238 - predicted gene 12238
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          RNA metabolism protein nucleic acid metabolism protein

          Gene Ontology Categories:

          Function(s) Process(es)

          transport
          negative regulation of canonical Wnt signaling pathway
          nucleotide binding
          nucleic acid binding
          DNA binding
          RNA binding
          mRNA binding
          helicase activity
          nuclease activity
          endonuclease activity
          protein binding
          ATP binding
          hydrolase activity
          poly(A) RNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline