Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Instrument Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • Our Instagram
      Our Instagram
    • Our Facebook
      Our Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 462673_mat
          Assay Name: rno-miR-19b-2*
          miRBase Accession Number: MI0000848
          miRBase Version: v22.1
          Chromosome Location: Chr.X: 140117379 - 140117474 [-] on Build Rnor_6.0
          Mature miRNA Sequence: AGUUUUGCAGAUUUGCAGUUCAG
          Species: Rat
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 462673_mat
          Size
          Availability Made To Order
          Catalog # 4440886
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000011, mir-19

          Mature miRNA Sequence:

          AGUUUUGCAGAUUUGCAGUUCAG

          Mature miRNA Details:



          Species miRBase ID miRBase Accession Number
          Rat rno-miR-19b-2-5p MIMAT0017097

          Stem-loop Details



          Rat

          Stem-loop ID rno-mir-19b-2
          Stem-loop Accession # MI0000848
          Stem-loop Sequence
          ACAUUGCUACUUACGGUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGGAUAUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUGAUGU
          Chromosome Location Chr. X - 140117379 - 140117474 [-] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0017097
          miRBase ID: rno-miR-19b-2-5p
          Mature miRNA Sequence: AGUUUUGCAGAUUUGCAGUUCAG
          Chromosome Location: Chr. X - 140117379 - 140117474 [-] on Build Rnor_6.0


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Rn03465594_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM19527
          Ambion® Pre-miR™ miRNA Precursor : PM19527
          mirVana® miRNA inhibitor : MH19527
          mirVana® miRNA mimic : MC19527
          TaqMan™ Advanced miRNA Assay : rno480986_mir


          miRBase Alias:

          Rat: rno-miR-19b-2* (v18)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Find Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline