Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 478501_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-141-3p
          Stem-loop Accession Number: MI0000457
          miRBase Version: v22.1
          Chromosome Location: Chr.12: 6964097 - 6964191 [+] on Build GRCh38
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Species: Human, Mouse, Rat, Bovine, Goat, Horse, Pan troglodytes, Pteropus alecto
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 478501_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000019, mir-8

          Mature miRNA Sequence:

          UAACACUGUCUGGUAAAGAUGG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-141-3p MIMAT0000432
          Mouse mmu-miR-141-3p MIMAT0000153
          Rat rno-miR-141-3p MIMAT0000846
          Bovine bta-miR-141 MIMAT0009232
          Goat chi-miR-141 MIMAT0035962
          Horse eca-miR-141 MIMAT0012970
          View More Rows
          Pan troglodytes ptr-miR-141 MIMAT0008036
          Pteropus alecto pal-miR-141-3p MIMAT0040098

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-141
          Stem-loop Accession # MI0000457
          Stem-loop Sequence
          CGGCCGGCCCUGGGUCCAUCUUCCAGUACAGUGUUGGAUGGUCUAAUUGUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCUCCCGGGUGGGUUC
          Chromosome Location Chr. 12 - 6964097 - 6964191 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0000432
          miRBase ID: hsa-miR-141-3p
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: Chr. 12 - 6964097 - 6964191 [+] on Build GRCh38

          Mouse

          Stem-loop ID mmu-mir-141
          Stem-loop Accession # MI0000166
          Stem-loop Sequence
          GGGUCCAUCUUCCAGUGCAGUGUUGGAUGGUUGAAGUAUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCCC
          Chromosome Location Chr. 6 - 124717914 - 124717985 [-] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0000153
          miRBase ID: mmu-miR-141-3p
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: Chr. 6 - 124717914 - 124717985 [-] on Build GRCm38

          Rat

          Stem-loop ID rno-mir-141
          Stem-loop Accession # MI0000914
          Stem-loop Sequence
          GGCUGACUCUGAGUCCAUCUUCCAGUGCAGUGUUGGAUGGUUGAAGUACGAAGCUCCUAACACUGUCUGGUAAAGAUGGCCCCCGGGUCAGUUC
          Chromosome Location Chr. 4 - 157236346 - 157236439 [-] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0000846
          miRBase ID: rno-miR-141-3p
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: Chr. 4 - 157236346 - 157236439 [-] on Build Rnor_6.0

          Bovine

          Stem-loop ID bta-mir-141
          Stem-loop Accession # MI0009742
          Stem-loop Sequence
          GACCGGCUCUGGGUCCAUCUUCCAGCACAGUGUUGGAUGGUCUAAUGGUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCCCCCGGCUGG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0009232
          miRBase ID: bta-miR-141
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: NA

          Goat

          Stem-loop ID chi-mir-141
          Stem-loop Accession # MI0030628
          Stem-loop Sequence
          GACCGGCUCUGGGUCCAUCUUCCAGCACAGUGUUGGAUGGUCUAAUGGUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCCCCCGGCUGG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0035962
          miRBase ID: chi-miR-141
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: NA

          Horse

          Stem-loop ID eca-mir-141
          Stem-loop Accession # MI0012723
          Stem-loop Sequence
          GGGUCCAUCUUCCAGUACAGUGUUGGAUGGUCUAAUUGUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCCC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0012970
          miRBase ID: eca-miR-141
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: NA

          Pan troglodytes

          Stem-loop ID ptr-mir-141
          Stem-loop Accession # MI0008541
          Stem-loop Sequence
          GGCCGGCCCUGGGUCCAUCUUCCAGUACAGUGUUGGAUGGUCUAAUUGUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCCCCCGGGUGGGUUC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0008036
          miRBase ID: ptr-miR-141
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: NA

          Pteropus alecto

          Stem-loop ID pal-mir-141
          Stem-loop Accession # MI0032492
          Stem-loop Sequence
          AUCUUCCAGUACAGUGUUGGAUGGUCUAAUUGUGAAGCUCCUAACACUGUCUGGUAAAGAUGG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0040098
          miRBase ID: pal-miR-141-3p
          Mature miRNA Sequence: UAACACUGUCUGGUAAAGAUGG
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm03306327_pri
          TaqMan™ Pri-miRNA Assay : Hs03303157_pri
          TaqMan™ Pri-miRNA Assay : Rn03464612_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM10860
          Ambion® Pre-miR™ miRNA Precursor : PM10860
          TaqMan™ MicroRNA Assay : 000463
          mirVana® miRNA inhibitor : MH10860
          mirVana® miRNA mimic : MC10860
          TaqMan™ Advanced miRNA Assay : mmu483016_mir
          TaqMan™ Advanced miRNA Assay : rno483016_mir
          FGMIR : TaqManTM Advanced miRNA Human Serum/Plasma 96-well Plate 1
          MIRNA : TaqMan® Advanced miRNA Human Serum/Plasma 96-well Plates, Standard
          FGMIR : TaqManTM Advanced miRNA Human Serum/Plasma Card
          MIRNA : TaqMan® Advanced miRNA Human A and B 96-well Plates, Standard
          FGMIR : TaqManTM Advanced miRNA Human Serum/Plasma 96-well Plate 1
          MIRNA : TaqMan® Advanced miRNA Human A 96-well Plates, Fast
          FGMIR : TaqManTM Advanced miRNA Human A 96-well Plate 1
          MIRNA : TaqMan® Advanced miRNA Human A Card
          MIRNA : TaqMan® Advanced miRNA Human Serum/Plasma Card
          MIRNA : TaqMan® OpenArray® Human Advanced MicroRNA Panel
          FGMIR : TaqManTM Advanced miRNA Human A 96-well Plate 1
          MIRNA : TaqMan® Advanced miRNA Human A 96-well Plates, Standard
          MIRNA : TaqMan® Advanced miRNA Human A and B 96-well Plates, Fast
          MIRNA : TaqMan® Advanced miRNA Human Serum/Plasma 96-well Plates, Fast
          FGMIR : QS TaqmanTM OpenArray Human Advanced miRNA Panel
          MIRNA : TaqMan® Advanced miRNA Human A and B Cards
          FGMIR : TaqManTM Advanced miRNA Human A Card

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline