Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 478998_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-539-3p
          Stem-loop Accession Number: MI0003514
          miRBase Version: v22.1
          Chromosome Location: Chr.14: 101047321 - 101047398 [+] on Build GRCh38
          Mature miRNA Sequence: AUCAUACAAGGACAAUUUCUUU
          Species: Human, Gorilla gorilla, Tupaia chinensis
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 478998_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000018, mir-154

          Mature miRNA Sequence:

          AUCAUACAAGGACAAUUUCUUU

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-539-3p MIMAT0022705
          Gorilla gorilla ggo-miR-539 MIMAT0049117
          Tupaia chinensis tch-miR-539-3p MIMAT0036505

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-539
          Stem-loop Accession # MI0003514
          Stem-loop Sequence
          AUACUUGAGGAGAAAUUAUCCUUGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGACAAUUUCUUUUUGAGUAU
          Chromosome Location Chr. 14 - 101047321 - 101047398 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0022705
          miRBase ID: hsa-miR-539-3p
          Mature miRNA Sequence: AUCAUACAAGGACAAUUUCUUU
          Chromosome Location: Chr. 14 - 101047321 - 101047398 [+] on Build GRCh38

          Gorilla gorilla

          Stem-loop ID ggo-mir-539
          Stem-loop Accession # MI0039829
          Stem-loop Sequence
          GGAGAAAUUAUCCUUGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGACAAUUUCUUU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0049117
          miRBase ID: ggo-miR-539
          Mature miRNA Sequence: AUCAUACAAGGACAAUUUCUUU
          Chromosome Location: NA

          Tupaia chinensis

          Stem-loop ID tch-mir-539
          Stem-loop Accession # MI0031162
          Stem-loop Sequence
          AGAGAUUGUCCUCGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGACAAUUUCUUU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0036505
          miRBase ID: tch-miR-539-3p
          Mature miRNA Sequence: AUCAUACAAGGACAAUUUCUUU
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03305121_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM22867
          Ambion® Pre-miR™ miRNA Precursor : PM22867
          TaqMan™ MicroRNA Assay : 477262_mat
          mirVana® miRNA inhibitor : MH22867
          mirVana® miRNA mimic : MC22867

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline