Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Pipettes and Pipette Tips
    • Lab Centrifuges
    • Ultra-Low Temperature Freezers
    • Spectroscopy
    • Beakers
    • PCR Equipment and Supplies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all product categories
  • Applications
    • Cell Analysis
    • Lab Equipment
    • Real-Time PCR
    • PCR
    • Chromatography
    • Cell Culture and Transfection
    • DNA and RNA Extraction and Analysis
    • Protein Biology
    • Flow Cytometry
    • Chemicals
    • See all applications and techniques
  • Services
    • Custom Services
    • Lab Informatics
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Instrument Services
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Customer Center
    • Contact Us
    • Certificates of Analysis and Conformance
    • Safety Data Sheets (SDS)
    • Manuals
    • How to Cite Our Products in a Paper
    • Instrument Support
    • Knowledge Base and Product FAQs
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 001994
          Assay Name: hsa-miR-801
          miRBase Version: v22.1
          Chromosome Location: -
          Mature miRNA Sequence: GAUUGCUCUGCGUGCGGAAUCGAC
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 001994
          Size
          Availability Inventoried
          Catalog # 4427975
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          GAUUGCUCUGCGUGCGGAAUCGAC

          Back To Top

          More Information


          Updated Mapping Information

          This assay detects a miRNA target from an earlier version of miRbase that has been obsoleted in miRbase v.22. This assay is still available for purchase for continuity of studies. For full target details including sequence, please refer to the miRbase database at http://www.mirbase.org/.


          Related Products

          miRNA Card : TaqMan® Human MicroRNA B Cards v2.0


          miRBase Alias:

          Human: hsa-miR-801 (v10)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Fair Trade Fair Trade
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Thermo Fisher Scientific Korea Ltd.
          Representative : Soojin Seok
          Company Registration No. : 117-81-46910

           

          Thermo Fisher Scientific Solutions LLC
          Representative : Soojin Seok
          Company Registration No. : 114-86-04783

           

          Location: 12F Suseo Office Building, 281 Gwangpyeong-ro, Gangnam-gu, Seoul, Korea(06349) | Mail-Order Business Registration : 2015-Seoul Gangnam-00898 | Payment : ShinHan Bank 140-004-396660 (Thermo Fisher Scientific Solutions LLC)

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline