Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 243756_mat
          Assay Name: tgu-miR-125-2*
          miRBase Accession Number: MI0033072
          miRBase Version: v22.1
          Chromosome Location: -
          Mature miRNA Sequence: ACGGGUUAGGCUCUUGGGAGC
          Species: Chrysemys picta, Cricetulus griseus, Monodelphis domestica, Taeniopygia guttata, Xenopus laevis
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 243756_mat
          Size
          Availability Made To Order
          Catalog # 4440886
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          ACGGGUUAGGCUCUUGGGAGC

          Mature miRNA Details:



          Species miRBase ID miRBase Accession Number
          Chrysemys picta cpi-miR-125b-3p MIMAT0037731
          Cricetulus griseus cgr-miR-125b MIMAT0041143
          Monodelphis domestica mdo-miR-125b-2-3p MIMAT0031106
          Taeniopygia guttata tgu-miR-125-2-3p MIMAT0014685
          Xenopus laevis xla-miR-125b-3p MIMAT0046434

          Stem-loop Details



          Chrysemys picta

          Stem-loop ID cpi-mir-125b-1
          Stem-loop Accession # MI0029460
          Stem-loop Sequence
          UGUUGCGCCCCUCUCAAUCCCUGAGACCCUAACUUGUGAUGUUUAGCUUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGUGAGUUGUGCUUUGACAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0037731
          miRBase ID: cpi-miR-125b-3p
          Mature miRNA Sequence: ACGGGUUAGGCUCUUGGGAGC
          Chromosome Location: NA

          Cricetulus griseus

          Stem-loop ID cgr-mir-125b-2
          Stem-loop Accession # MI0033072
          Stem-loop Sequence
          AGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0041143
          miRBase ID: cgr-miR-125b
          Mature miRNA Sequence: ACGGGUUAGGCUCUUGGGAGC
          Chromosome Location: NA

          Monodelphis domestica

          Stem-loop ID mdo-mir-125b-2
          Stem-loop Accession # MI0005292
          Stem-loop Sequence
          AAUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0031106
          miRBase ID: mdo-miR-125b-2-3p
          Mature miRNA Sequence: ACGGGUUAGGCUCUUGGGAGC
          Chromosome Location: NA

          Taeniopygia guttata

          Stem-loop ID tgu-mir-125-2
          Stem-loop Accession # MI0013696
          Stem-loop Sequence
          CCCCUCUCAAUCCCUGAGACCCUAACUUGUGAUGUUUAGCUUUUAAAUCCACGGGUUAGGCUCUUGGGAGCU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0014685
          miRBase ID: tgu-miR-125-2-3p
          Mature miRNA Sequence: ACGGGUUAGGCUCUUGGGAGC
          Chromosome Location: NA

          Xenopus laevis

          Stem-loop ID xla-mir-125b
          Stem-loop Accession # MI0038239
          Stem-loop Sequence
          UCCCUGAGACCCUAACUUGUGAUGUUUAGCUUUAAAAAUCCACGGGUUAGGCUCUUGGGAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0046434
          miRBase ID: xla-miR-125b-3p
          Mature miRNA Sequence: ACGGGUUAGGCUCUUGGGAGC
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          mirVana® miRNA inhibitor : MH18815
          mirVana® miRNA mimic : MC18815


          miRBase Alias:

          Trabulsiella guamensis ATCC 49490: tgu-miR-125-2* (v18)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline