Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 462041_mat
          Assay Name: rno-miR-328a*
          miRBase Accession Number: MI0000602
          miRBase Version: v22.1
          Chromosome Location: Chr.19: 37263199 - 37263282 [-] on Build Rnor_6.0
          Mature miRNA Sequence: GGGGGGCAGGAGGGGCUCA
          Species: Rat
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 462041_mat
          Size
          Availability Made To Order
          Catalog # 4440886
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000203, mir-328

          Mature miRNA Sequence:

          GGGGGGCAGGAGGGGCUCA

          Mature miRNA Details:



          Species miRBase ID miRBase Accession Number
          Rat rno-miR-328a-5p MIMAT0017029

          Stem-loop Details



          Rat

          Stem-loop ID rno-mir-328a
          Stem-loop Accession # MI0000602
          Stem-loop Sequence
          UGGGGCAGGGGGGCAGGAGGGGCUCAGGGAGAAAGCAUCUACAGCCCCUGGCCCUCUCUGCCCUUCCGUCCCCUGUCCCCAAAU
          Chromosome Location Chr. 19 - 37263199 - 37263282 [-] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0017029
          miRBase ID: rno-miR-328a-5p
          Mature miRNA Sequence: GGGGGGCAGGAGGGGCUCA
          Chromosome Location: Chr. 19 - 37263199 - 37263282 [-] on Build Rnor_6.0


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Rn03465910_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM19823
          Ambion® Pre-miR™ miRNA Precursor : PM19823
          mirVana® miRNA inhibitor : MH19823
          mirVana® miRNA mimic : MC19823
          TaqMan™ Advanced miRNA Assay : rno481494_mir


          miRBase Alias:

          Rat: rno-miR-328a* (v18)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline