Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 478314_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-193b-3p
          Stem-loop Accession Number: MI0003137
          miRBase Version: v22.1
          Chromosome Location: Chr.16: 14303967 - 14304049 [+] on Build GRCh38
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Species: Human, Callithrix jacchus, Nomascus leucogenys, Pan troglodytes, Papio hamadryas, Pongo pygmaeus, Rhesus monkey
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 478314_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000082, mir-193

          Mature miRNA Sequence:

          AACUGGCCCUCAAAGUCCCGCU

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-193b-3p MIMAT0002819
          Callithrix jacchus cja-miR-193 MIMAT0039349
          Nomascus leucogenys nle-miR-193b MIMAT0049412
          Pan troglodytes ptr-miR-193b MIMAT0008059
          Papio hamadryas pha-miR-193b MIMAT0049567
          Pongo pygmaeus ppy-miR-193b MIMAT0015789
          View More Rows
          Rhesus monkey mml-miR-193b-3p MIMAT0006227

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-193b
          Stem-loop Accession # MI0003137
          Stem-loop Sequence
          GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCUUUUGGGGUCAU
          Chromosome Location Chr. 16 - 14303967 - 14304049 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0002819
          miRBase ID: hsa-miR-193b-3p
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Chromosome Location: Chr. 16 - 14303967 - 14304049 [+] on Build GRCh38

          Callithrix jacchus

          Stem-loop ID cja-mir-193
          Stem-loop Accession # MI0031864
          Stem-loop Sequence
          GUGGUCCCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUUUUUUAUCCAACUGGCCCUCAAAGUCCCGCUUUUGGGGUCAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0039349
          miRBase ID: cja-miR-193
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Chromosome Location: NA

          Nomascus leucogenys

          Stem-loop ID nle-mir-193b
          Stem-loop Accession # MI0040153
          Stem-loop Sequence
          CGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0049412
          miRBase ID: nle-miR-193b
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Chromosome Location: NA

          Pan troglodytes

          Stem-loop ID ptr-mir-193b
          Stem-loop Accession # MI0008567
          Stem-loop Sequence
          UGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCUUUUGGGGUCAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0008059
          miRBase ID: ptr-miR-193b
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Chromosome Location: NA

          Papio hamadryas

          Stem-loop ID pha-mir-193b
          Stem-loop Accession # MI0040337
          Stem-loop Sequence
          CGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0049567
          miRBase ID: pha-miR-193b
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Chromosome Location: NA

          Pongo pygmaeus

          Stem-loop ID ppy-mir-193b
          Stem-loop Accession # MI0014856
          Stem-loop Sequence
          GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCUUUUGGGGUCAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0015789
          miRBase ID: ppy-miR-193b
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Chromosome Location: NA

          Rhesus monkey

          Stem-loop ID mml-mir-193b
          Stem-loop Accession # MI0007656
          Stem-loop Sequence
          GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCUUUUGGGGUCAU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0006227
          miRBase ID: mml-miR-193b-3p
          Mature miRNA Sequence: AACUGGCCCUCAAAGUCCCGCU
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03303897_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM12383
          Ambion® Pre-miR™ miRNA Precursor : PM12383
          TaqMan™ MicroRNA Assay : 002367
          mirVana® miRNA inhibitor : MH12383
          mirVana® miRNA mimic : MC12383
          MIRNA : TaqMan® Advanced miRNA Human A and B 96-well Plates, Standard
          MIRNA : TaqMan® OpenArray® Human Advanced MicroRNA Panel
          FGMIR : QS TaqmanTM OpenArray Human Advanced miRNA Panel
          FGMIR : TaqManTM Advanced miRNA Human A Card
          FGMIR : TaqManTM Advanced miRNA Human A 96-well Plate 2
          FGMIR : TaqManTM Advanced miRNA Human Serum/Plasma 96-well Plate 1
          MIRNA : TaqMan® Advanced miRNA Human A 96-well Plates, Fast
          MIRNA : TaqMan® Advanced miRNA Human A and B Cards
          MIRNA : TaqMan® Advanced miRNA Human Serum/Plasma 96-well Plates, Fast
          FGMIR : TaqManTM Advanced miRNA Human Serum/Plasma 96-well Plate 1
          MIRNA : TaqMan® Advanced miRNA Human A Card
          MIRNA : TaqMan® Advanced miRNA Human Serum/Plasma Card
          FGMIR : TaqManTM Advanced miRNA Human Serum/Plasma Card
          MIRNA : TaqMan® Advanced miRNA Human A 96-well Plates, Standard
          FGMIR : TaqManTM Advanced miRNA Human A 96-well Plate 2
          MIRNA : TaqMan® Advanced miRNA Human Serum/Plasma 96-well Plates, Standard
          MIRNA : TaqMan® Advanced miRNA Human A and B 96-well Plates, Fast

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-blue-7fb9f846c9-wx6nt:80/100.66.72.150:80.
          git-commit: 8207b5afa5c305bd40e0a4f0b9b53fd46f2a8829
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.59.1-2026.09.91-1.0