Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 480009_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-4753-5p
          Stem-loop Accession Number: MI0017392
          miRBase Version: v22.1
          Chromosome Location: Chr.1: 235190034 - 235190116 [-] on Build GRCh38
          Mature miRNA Sequence: CAAGGCCAAAGGAAGAGAACAG
          Species: Human
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 480009_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          CAAGGCCAAAGGAAGAGAACAG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-4753-5p MIMAT0019890

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-4753
          Stem-loop Accession # MI0017392
          Stem-loop Sequence
          AUAUCUACACAAGGCCAAAGGAAGAGAACAGAUAUAUCCACAGUACACUUGGCUGUUCUCUUUCUUUAGCCUUGUGUAGAUAU
          Chromosome Location Chr. 1 - 235190034 - 235190116 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0019890
          miRBase ID: hsa-miR-4753-5p
          Mature miRNA Sequence: CAAGGCCAAAGGAAGAGAACAG
          Chromosome Location: Chr. 1 - 235190034 - 235190116 [-] on Build GRCh38


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs04257809_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM21778
          Ambion® Pre-miR™ miRNA Precursor : PM21778
          TaqMan™ MicroRNA Assay : 463024_mat
          mirVana® miRNA inhibitor : MH21778
          mirVana® miRNA mimic : MC21778

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline