Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 480340_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-6785-3p
          Stem-loop Accession Number: MI0022630
          miRBase Version: v22.1
          Chromosome Location: Chr.17: 75498548 - 75498628 [+] on Build GRCh38
          Mature miRNA Sequence: ACAUCGCCCCACCUUCCCCAG
          Species: Human
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 480340_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          ACAUCGCCCCACCUUCCCCAG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-6785-3p MIMAT0027471

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-6785
          Stem-loop Accession # MI0022630
          Stem-loop Sequence
          CUCCCUGGGAGGGCGUGGAUGAUGGUGGGAGAGGAGCCCCACUGUGGAAGUCUGACCCCCACAUCGCCCCACCUUCCCCAG
          Chromosome Location Chr. 17 - 75498548 - 75498628 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0027471
          miRBase ID: hsa-miR-6785-3p
          Mature miRNA Sequence: ACAUCGCCCCACCUUCCCCAG
          Chromosome Location: Chr. 17 - 75498548 - 75498628 [+] on Build GRCh38


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs04348169_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM27064
          Ambion® Pre-miR™ miRNA Precursor : PM27064
          mirVana® miRNA inhibitor : MH27064
          mirVana® miRNA mimic : MC27064

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-zdkzh:80/100.66.76.145:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline