Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › AM12859
          Assay Name: hsa-miR-105-3p
          miRBase Accession Number: MI0000111
          miRBase Version: v22.1
          Chromosome Location: Chr.X: 152392219 - 152392299 [-] on Build GRCh38
          Mature miRNA Sequence: ACGGAUGUUUGAGCAUGUGCUA
          Species: Human, Rhesus monkey
          Product Type: Ambion® Anti-miR™ miRNA Inhibitor
          Assay ID AM12859
          Size
          Availability Made To Order
          Catalog # AM17000
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000074, mir-105

          Mature miRNA Sequence:

          ACGGAUGUUUGAGCAUGUGCUA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-105-3p MIMAT0004516
          Rhesus monkey mml-miR-105-3p MIMAT0026583

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-105-1
          Stem-loop Accession # MI0000111
          Stem-loop Sequence
          UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUCAUGCACCACGGAUGUUUGAGCAUGUGCUACGGUGUCUA
          Chromosome Location Chr. X - 152392219 - 152392299 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004516
          miRBase ID: hsa-miR-105-3p
          Mature miRNA Sequence: ACGGAUGUUUGAGCAUGUGCUA
          Chromosome Location: Chr. X - 152394412 - 152394492 [-] on Build GRCh38

          Stem-loop ID hsa-mir-105-2
          Stem-loop Accession # MI0000112
          Stem-loop Sequence
          UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUUAUGCACCACGGAUGUUUGAGCAUGUGCUAUGGUGUCUA
          Chromosome Location Chr. X - 152394412 - 152394492 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004516
          miRBase ID: hsa-miR-105-3p
          Mature miRNA Sequence: ACGGAUGUUUGAGCAUGUGCUA
          Chromosome Location: Chr. X - 152394412 - 152394492 [-] on Build GRCh38

          Rhesus monkey

          Stem-loop ID mml-mir-105-1
          Stem-loop Accession # MI0002750
          Stem-loop Sequence
          UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUCAUGCACCACGGAUGUUUGAGCAUGUGCUACGGUGUCUA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0026583
          miRBase ID: mml-miR-105-3p
          Mature miRNA Sequence: ACGGAUGUUUGAGCAUGUGCUA
          Chromosome Location: NA

          Stem-loop ID mml-mir-105-2
          Stem-loop Accession # MI0007612
          Stem-loop Sequence
          UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUUAUGCACCACGGAUGUUUGAGCAUGUGCUAUGGUGUCUA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0026583
          miRBase ID: mml-miR-105-3p
          Mature miRNA Sequence: ACGGAUGUUUGAGCAUGUGCUA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03302772_pri
          TaqMan™ Pri-miRNA Assay : Hs03302770_pri
          Ambion® Pre-miR™ miRNA Precursor : PM12859
          TaqMan™ MicroRNA Assay : 002168
          mirVana® miRNA inhibitor : MH12859
          mirVana® miRNA mimic : MC12859
          TaqMan™ Advanced miRNA Assay : 478622_mir


          miRBase Alias:

          Human: hsa-miR-105* (v17)

          Back To Top

          Related Products

          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline