Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › PM13109
          Assay Name: hsa-miR-122-3p
          miRBase Accession Number: MI0000442
          miRBase Version: v22.1
          Chromosome Location: Chr.18: 58451074 - 58451158 [+] on Build GRCh38
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Species: Human, Anolis carolinensis, Chicken, Columba livia, Dasypus novemcinctus, Guinea pig, Python bivittatus, Rabbit, Salmo salar
          Product Type: Ambion® Pre-miR™ miRNA Precursor
          Assay ID PM13109
          Size
          Availability Made To Order
          Catalog # AM17100
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000095, mir-122

          Mature miRNA Sequence:

          AACGCCAUUAUCACACUAAAUA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-122-3p MIMAT0004590
          Anolis carolinensis aca-miR-122-3p MIMAT0021724
          Chicken gga-miR-122-3p MIMAT0026550
          Columba livia cli-miR-122-3p MIMAT0038492
          Dasypus novemcinctus dno-miR-122-3p MIMAT0047611
          Guinea pig cpo-miR-122-3p MIMAT0046962
          View More Rows
          Python bivittatus pbv-miR-122-3p MIMAT0038910
          Rabbit ocu-miR-122-3p MIMAT0048202
          Salmo salar ssa-miR-122-2-3p MIMAT0032303

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-122
          Stem-loop Accession # MI0000442
          Stem-loop Sequence
          CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC
          Chromosome Location Chr. 18 - 58451074 - 58451158 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004590
          miRBase ID: hsa-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: Chr. 18 - 58451074 - 58451158 [+] on Build GRCh38

          Anolis carolinensis

          Stem-loop ID aca-mir-122
          Stem-loop Accession # MI0018719
          Stem-loop Sequence
          UCCUGCUGGAGCUGUGGAGUGUGACAAUGGUGUUUGUAUCCAAUCCGUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGAG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0021724
          miRBase ID: aca-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Chicken

          Stem-loop ID gga-mir-122-1
          Stem-loop Accession # MI0001277
          Stem-loop Sequence
          CAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCAAUCUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGGUAG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0026550
          miRBase ID: gga-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Stem-loop ID gga-mir-122-2
          Stem-loop Accession # MI0001280
          Stem-loop Sequence
          CAGAGCUAUGGAGUGUGACAAUGGUGUUUGUGUCCAAUCUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGGUAG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0026550
          miRBase ID: gga-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Columba livia

          Stem-loop ID cli-mir-122
          Stem-loop Accession # MI0029953
          Stem-loop Sequence
          CUGCCCGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCUGGCUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGGUAGACA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0038492
          miRBase ID: cli-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Dasypus novemcinctus

          Stem-loop ID dno-mir-122
          Stem-loop Accession # MI0038963
          Stem-loop Sequence
          UGGAGUGUGACAAUGGUGUUUGUGUCCACAAUAUCAAACGCCAUUAUCACACUAAAUA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0047611
          miRBase ID: dno-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Guinea pig

          Stem-loop ID cpo-mir-122
          Stem-loop Accession # MI0038621
          Stem-loop Sequence
          UGGAGUGUGACAAUGGUGUUUGUGUCCAAACUAUCAAACGCCAUUAUCACACUAAAUA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0046962
          miRBase ID: cpo-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Python bivittatus

          Stem-loop ID pbv-mir-122
          Stem-loop Accession # MI0030210
          Stem-loop Sequence
          UUCUGCUGGAGCUUUGGAGUGUGACAAUGGUGUUUGUAUCCAAUCUCUCAAACGCCAUUAUCACACUAAAUAGCUACUGUUAGA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0038910
          miRBase ID: pbv-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Rabbit

          Stem-loop ID ocu-mir-122
          Stem-loop Accession # MI0039275
          Stem-loop Sequence
          UGGAGUGUGACAAUGGUGUUUGUGUCCAAACUAUCAAACGCCAUUAUCACACUAAAUA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0048202
          miRBase ID: ocu-miR-122-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA

          Salmo salar

          Stem-loop ID ssa-mir-122-2
          Stem-loop Accession # MI0026451
          Stem-loop Sequence
          UGGAGUGUGACAAUGGUGUUUGUGUUCUCUGCAAUCAAACGCCAUUAUCACACUAAAUA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0032303
          miRBase ID: ssa-miR-122-2-3p
          Mature miRNA Sequence: AACGCCAUUAUCACACUAAAUA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03303072_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM13109
          TaqMan™ MicroRNA Assay : 002130
          mirVana® miRNA inhibitor : MH13109
          mirVana® miRNA mimic : MC13109
          TaqMan™ Advanced miRNA Assay : 477874_mir


          miRBase Alias:

          Human: hsa-miR-122* (v17)
          Aeromonas caviae Ae398: aca-miR-122* (v18)

          Back To Top

          Related Products

          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline