Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › PM13679
          Assay Name: hsa-miR-1290
          miRBase Accession Number: MI0006352
          miRBase Version: v22.1
          Chromosome Location: Chr.1: 18897071 - 18897148 [-] on Build GRCh38
          Mature miRNA Sequence: UGGAUUUUUGGAUCAGGGA
          Species: Human, Pan troglodytes
          Product Type: Ambion® Pre-miR™ miRNA Precursor
          Assay ID PM13679
          Size
          Availability Made To Order
          Catalog # AM17100
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000610, mir-1290

          Mature miRNA Sequence:

          UGGAUUUUUGGAUCAGGGA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-1290 MIMAT0005880
          Pan troglodytes ptr-miR-1290 MIMAT0008008

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-1290
          Stem-loop Accession # MI0006352
          Stem-loop Sequence
          GAGCGUCACGUUGACACUCAAAAAGUUUCAGAUUUUGGAACAUUUCGGAUUUUGGAUUUUUGGAUCAGGGAUGCUCAA
          Chromosome Location Chr. 1 - 18897071 - 18897148 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0005880
          miRBase ID: hsa-miR-1290
          Mature miRNA Sequence: UGGAUUUUUGGAUCAGGGA
          Chromosome Location: Chr. 1 - 18897071 - 18897148 [-] on Build GRCh38

          Pan troglodytes

          Stem-loop ID ptr-mir-1290
          Stem-loop Accession # MI0008491
          Stem-loop Sequence
          GAGCGUCGUGUUGACACUCAAAAAGUUUCAGAUUUUGGAACAUUUCGGAUUUUGGAUUUUUGGAUCAGGGAUGCUCA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0008008
          miRBase ID: ptr-miR-1290
          Mature miRNA Sequence: UGGAUUUUUGGAUCAGGGA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03305533_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM13679
          TaqMan™ MicroRNA Assay : 002863
          mirVana® miRNA inhibitor : MH13679
          mirVana® miRNA mimic : MC13679
          TaqMan™ Advanced miRNA Assay : 477895_mir

          Back To Top

          Related Products

          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0