Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › mmu481267_mir

          Specificity testing was performed using mouse anti-targets.

          Assay Name: mmu-miR-7a-2-3p
          Stem-loop Accession Number: MI0000729
          miRBase Version: v22.1
          Chromosome Location: Chr.7: 78888277 - 78888373 [+] on Build GRCm38
          Mature miRNA Sequence: CAACAAGUCCCAGUCUGCCACA
          Species: Mouse, Rat, Pteropus alecto
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID mmu481267_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000022, mir-7

          Mature miRNA Sequence:

          CAACAAGUCCCAGUCUGCCACA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-7a-2-3p MIMAT0017070
          Rat rno-miR-7a-2-3p MIMAT0017091
          Pteropus alecto pal-miR-7a-3p MIMAT0040113

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-7a-2
          Stem-loop Accession # MI0000729
          Stem-loop Sequence
          GGUCGGGCCAGCCCCGUUUGGAAGACUAGUGAUUUUGUUGUUGUGUCUCUGUAUCCAACAACAAGUCCCAGUCUGCCACAUGGUGCUGGUCAUUUCA
          Chromosome Location Chr. 7 - 78888277 - 78888373 [+] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0017070
          miRBase ID: mmu-miR-7a-2-3p
          Mature miRNA Sequence: CAACAAGUCCCAGUCUGCCACA
          Chromosome Location: Chr. 7 - 78888277 - 78888373 [+] on Build GRCm38

          Rat

          Stem-loop ID rno-mir-7a-2
          Stem-loop Accession # MI0000836
          Stem-loop Sequence
          GGACAGACCAGCCCUGUCUGGAAGACUAGUGAUUUUGUUGUUGUGUCUGUGUCCAACAACAAGUCCCAGUCUGCCACAUGGUGUUGGUCACAUCA
          Chromosome Location Chr. 1 - 140576396 - 140576490 [+] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0017091
          miRBase ID: rno-miR-7a-2-3p
          Mature miRNA Sequence: CAACAAGUCCCAGUCUGCCACA
          Chromosome Location: Chr. 1 - 140576396 - 140576490 [+] on Build Rnor_6.0

          Pteropus alecto

          Stem-loop ID pal-mir-7a
          Stem-loop Accession # MI0032500
          Stem-loop Sequence
          UGGAAGACCGGUGAUUUUGUUGUUGUCUCUCUGUGCUCAACAACAAGUCCCAGUCUGCCACA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0040113
          miRBase ID: pal-miR-7a-3p
          Mature miRNA Sequence: CAACAAGUCCCAGUCUGCCACA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm03307288_pri
          TaqMan™ Pri-miRNA Assay : Rn03465955_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM19845
          Ambion® Pre-miR™ miRNA Precursor : PM19845
          TaqMan™ MicroRNA Assay : 462860_mat
          mirVana® miRNA inhibitor : MH19845
          mirVana® miRNA mimic : MC19845
          TaqMan™ Advanced miRNA Assay : rno481267_mir

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline