Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Clinical Genomics
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › mmu481641_mir

          Specificity testing was performed using mouse anti-targets.

          Assay Name: mmu-miR-203-5p
          Stem-loop Accession Number: MI0000246
          miRBase Version: v22.1
          Chromosome Location: Chr.12: 112130880 - 112130955 [+] on Build GRCm38
          Mature miRNA Sequence: AGUGGUUCUUGACAGUUCAACA
          Species: Mouse, Salmo salar
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID mmu481641_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000108, mir-203

          Mature miRNA Sequence:

          AGUGGUUCUUGACAGUUCAACA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-203-5p MIMAT0004547
          Salmo salar ssa-miR-203b-5p MIMAT0032486

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-203
          Stem-loop Accession # MI0000246
          Stem-loop Sequence
          GCCUGGUCCAGUGGUUCUUGACAGUUCAACAGUUCUGUAGCACAAUUGUGAAAUGUUUAGGACCACUAGACCCGGC
          Chromosome Location Chr. 12 - 112130880 - 112130955 [+] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0004547
          miRBase ID: mmu-miR-203-5p
          Mature miRNA Sequence: AGUGGUUCUUGACAGUUCAACA
          Chromosome Location: Chr. 12 - 112130880 - 112130955 [+] on Build GRCm38

          Salmo salar

          Stem-loop ID ssa-mir-203b
          Stem-loop Accession # MI0026589
          Stem-loop Sequence
          AGUGGUUCUUGACAGUUCAACAGUCUUUACCAAAAUUGUGAAAUGUUUAGGACCACUCG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0032486
          miRBase ID: ssa-miR-203b-5p
          Mature miRNA Sequence: AGUGGUUCUUGACAGUUCAACA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm03306530_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM12483
          Ambion® Pre-miR™ miRNA Precursor : PM12483
          TaqMan™ MicroRNA Assay : 002580
          mirVana® miRNA inhibitor : MH12483
          mirVana® miRNA mimic : MC12483

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Hong Kong flag icon
          Hong Kong

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline