Search
Wastewater samples for virus detection can be taken at different locations and at different timepoints within the sewer system. For wider population, monitoring samples can be taken at the inlet to a processing plant, but when viral load is high, “near-source tracking” of drains in specific areas or buildings can help pinpoint the location of high levels of infection. There are two modes of sample collection; grab sampling or composite sampling (see below) but the requirements are the same:
- to ensure the sample is representative of source
- to ensure the sample is collected, stored and shipped safely
Find out more information on what and where to sample
How often should I collect samples?
Monitoring daily helps improve accuracy and average out the “noise” in wastewater data but twice weekly samples can still be useful. If the goal of wastewater surveillance is early indication of infection trends, at least three sampling points are needed within a trend period of interest.
What sampling method should I use?
Grab sampling
A ‘grab sample’ is a snapshot of virus load at a single point in time. It is usually taken at peak flow with the aim to increase the likelihood of capturing the most representative measure of shed virus (e.g. University dorm–morning flush; Industry–occupied hours).
Composite sampling
An autosampler collects regular samples over a set period (e.g. 24 hours) in preselected time windows to provide either a time series or to combine into one ‘composite sample’ mix to get a representative sample for the area.
Composite sampling is preferred as it increases the likelihood of detecting virus.
Sample containers which protect the microbiological and chemical integrity of the sample whilst offering a durable, break-resistant and leakproof closure ensure wastewater samples are stored safely.
Thermo Scientific Nalgene bottles and their caps are carefully engineered to work perfectly together, providing dependable leakproof performance, every time.
Autosamplers simplify composite sampling. They can be programmed to collect varying sample sizes, samples at user-specified time intervals or flow volume increments.
Designed for field based applications and available in three base sizes to fit a range of manhole sizes, the Hach®AS950 Portable Compact Portable Sampler is ideal for wastewater collection.
Inactivation of SARS-CoV-2 is essential to establish safe methods for handling live SARS-CoV-2 samples. Applying heat under controlled conditions, typically between 56°C and 65°C for at least 30 minutes will inactivate the virus without impacting detectable levels of mRNA.
As well as ensuring effective virus inactivation, Thermo Scientific Heratherm Advanced Protocol Security Incubators include a unique 140°C decontamination routine, lockable incubator door with alarm for restricted access, and automatic over- and under-temperature alarms.
Sample containers which protect the microbiological and chemical integrity of the sample whilst offering a durable, break-resistant and leakproof closure ensure wastewater samples are stored safely.
Thermo Scientific Nalgene bottles and their caps are carefully engineered to work perfectly together, providing dependable leakproof performance, every time.
Autosamplers simplify composite sampling. They can be programmed to collect varying sample sizes, samples at user-specified time intervals or flow volume increments.
Designed for field based applications and available in three base sizes to fit a range of manhole sizes, the Hach®AS950 Portable Compact Portable Sampler is ideal for wastewater collection.
Inactivation of SARS-CoV-2 is essential to establish safe methods for handling live SARS-CoV-2 samples. Applying heat under controlled conditions, typically between 56°C and 65°C for at least 30 minutes will inactivate the virus without impacting detectable levels of mRNA.
As well as ensuring effective virus inactivation, Thermo Scientific Heratherm Advanced Protocol Security Incubators include a unique 140°C decontamination routine, lockable incubator door with alarm for restricted access, and automatic over- and under-temperature alarms.
Normalising samples with population biomarkers
It is important to normalise SARS-CoV-2 concentrations by the population number served by the sewer system, especially if the number of people contributing to the wastewater in a particular location is expected to vary (for example due to tourism, weekday commuters or temporary workers). This provides a better understanding of fluctuations in viral RNA concentration, allowing for comparisons of wastewater samples over time and between locations.
Several options exist that may allow estimation of relative human faecal load including:
- Genetic biomarkers for example human mitochondrial DNA or RNA, cross-assembly phage (crAssphage) or pepper mild mottle virus (PMMoV)
- Organic or inorganic compounds (wet chemical data), such as ammoniacal nitrogen, urea and creatinine and contaminants, like pharmaceuticals
As well as normalising for human faecal load, it is important to consider collecting data to normalise for other variations in wastewater due to for example changes in flow (heavy rainfall or drought) and pH (which can impact the stability of the virus).
Population biomarkers are required to normalise SARS-CoV-2 trends and
generate meaningful data from wastewater
The HERA report recommends the use of cross-assembly phage or pepper mild mottle virus as a control for normalising human faecal load. High quality primers and TaqMan MGB probes can be designed to detect these by RT-qPCR using our Custom TaqMan Assay Design Tool.
Our wastewater assay kit for dPCR now includes primers for detecting and normalising with PPMoV.
Sequence information for designing primers and probes for PPMMoV1
Pepper Mild Mottle virus (PPMoV) Positive control5’NNNNNNNNNNAATGAGAGTGGTTTGACCTTAACGTTTGAGCGGCCTACCGAAGCAAATGTCGCACTTGCATTGCAACCGACAATTGCANNNNNNNNNNNN3’
Forward primer _PMMV:GAGTGGTTTGACCTTAACGTTTGA
Reverse primer _PMMV:TTGTCGGTTGCAATGCAAGT
TaqMan MGB probe PMMV-Probe1: FAM-CCTACCGAAGCAAATG-NFQ-MGB
1 Greenwald et al, One-Step RT-qPCR for SARS-CoV-2 Wastewater Surveillance: N1, PMMoV, BCoV, SOC, CrAssphage, Bacteroides rRNA, 18S rRNA V.2, https://dx.doi.org/10.17504/protocols.io.bsgvnbw6
Haramoto et al (2020), First environmental surveillance for the presence of SARS-CoV-2 RNA in wastewater and river water in Japan, Science of The Total Environment, 737: 140405
Stachler et al (2017), Quantitative CrAssphage PCR Assays for Human Fecal Pollution Measurement, Environmental Science & Technology, 51: 9146–9154
Monitoring of ammoniacal nitrogen, phosphorus, urea and creatinine levels also provides an estimation of relative human faecal load and can be used to normalise molecular data. Traditionally these chemicals would be analysed separately, with each test requiring a separate sample and often multiple sequential steps. Thermo Scientific Gallery Plus Discrete Analyzer automate this wet chemical testing utilising colorimetric and enzymatic measurements of several analytes simultaneously from a single sample through photometric analysis.
You can hear how the UK Environmental Agency implemented automated wet chemical analysis into their wastewater surveillance for SARS-CoV-2 here.
Find out more about our solutions for general wastewater testing
The HERA report recommends the use of cross-assembly phage or pepper mild mottle virus as a control for normalising human faecal load. High quality primers and TaqMan MGB probes can be designed to detect these by RT-qPCR using our Custom TaqMan Assay Design Tool.
Our wastewater assay kit for dPCR now includes primers for detecting and normalising with PPMoV.
Sequence information for designing primers and probes for PPMMoV1
Pepper Mild Mottle virus (PPMoV) Positive control5’NNNNNNNNNNAATGAGAGTGGTTTGACCTTAACGTTTGAGCGGCCTACCGAAGCAAATGTCGCACTTGCATTGCAACCGACAATTGCANNNNNNNNNNNN3’
Forward primer _PMMV:GAGTGGTTTGACCTTAACGTTTGA
Reverse primer _PMMV:TTGTCGGTTGCAATGCAAGT
TaqMan MGB probe PMMV-Probe1: FAM-CCTACCGAAGCAAATG-NFQ-MGB
1 Greenwald et al, One-Step RT-qPCR for SARS-CoV-2 Wastewater Surveillance: N1, PMMoV, BCoV, SOC, CrAssphage, Bacteroides rRNA, 18S rRNA V.2, https://dx.doi.org/10.17504/protocols.io.bsgvnbw6
Haramoto et al (2020), First environmental surveillance for the presence of SARS-CoV-2 RNA in wastewater and river water in Japan, Science of The Total Environment, 737: 140405
Stachler et al (2017), Quantitative CrAssphage PCR Assays for Human Fecal Pollution Measurement, Environmental Science & Technology, 51: 9146–9154
Monitoring of ammoniacal nitrogen, phosphorus, urea and creatinine levels also provides an estimation of relative human faecal load and can be used to normalise molecular data. Traditionally these chemicals would be analysed separately, with each test requiring a separate sample and often multiple sequential steps. Thermo Scientific Gallery Plus Discrete Analyzer automate this wet chemical testing utilising colorimetric and enzymatic measurements of several analytes simultaneously from a single sample through photometric analysis.
You can hear how the UK Environmental Agency implemented automated wet chemical analysis into their wastewater surveillance for SARS-CoV-2 here.
Find out more about our solutions for general wastewater testing
For Research Use Only. Not for use in diagnostic procedures.
Style Sheet for Global Design System
Style Sheet for Komodo Tabs