Hamburger Menu Button
Thermo Fisher Scientific Logo
Se connecter
Vous n’avez pas de compte? Créer votre compte
  • Produits
    • Anticorps
    • Oligos, amorces, sondes et gènes
    • Réactions PCR en temps réel Taqman
    • Milieux de culture cellulaire
    • Produits chimiques
    • Colonnes et cartouches de chromatographie
    • Équipement de laboratoire
    • Consommables en plastique et fournitures de laboratoire
    • Microplaques
    • Produits plus écologiques
    • Afficher toutes les catégories de produits
  • Applications
    • Bioprocédés
    • Culture cellulaire et transfection
    • Thérapie cellulaire et génétique
    • Chromatographie
    • Tests moléculaires
    • Solutions numériques
    • Extraction et analyse d’ADN et d’ARN
    • Spectroscopie, analyse élémentaire et isotopique
    • Voir toutes les applications et techniques
  • Services
    • Services CDMO et CRO à 360°
    • Services CDMO
    • Services CRO
    • Services personnalisés
    • Services financiers et leasing
    • Services pour les instruments
    • Informatique de laboratoire
    • Offres commerciales et OEM
    • Services de formation
    • Unity Lab Services
    • Voir tous les services
  • Aide et assistance
    • S’inscrire et créer un compte
    • Comment commander
    • Assistance instruments
    • Centres d’assistance technique
    • Centres d’apprentissage
    • Consultez toutes les rubriques d'aide et d'assistance
  • Populaire
    • TaqMan Real-Time PCR Assays
      Reaction PCR en temps réel TaqMan
    • Antibodies
      Anticorps
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt - Synthèse Gène
    • Cell Culture Plastics
      Plastiques culture cellulaire
  • Nos clients
    • Biotechnologie
    • Industrie biopharmaceutique
    • CDMO
    • Diagnostics de laboratoire
    • Sciences industrielles et appliquées associées
  • Promotions
  • Contactez-nous
  • Commande rapide
  • Suivi et statut de la commande
  • Documents et certificats
Thermo Fisher Scientific Logo

Search

Rechercher
Search button
          • Statut des commandes
          • Commande rapide
          • Promos
          • Se connecter
            Se connecter
            Vous n’avez pas de compte? Créer votre compte
            • Mon compte
            • Commandes
            • Connect: lab, données, apps
            • Produits personnalisés et projets
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_102099671_10
          See other PRMT7 GT Assays ›
          SNP ID:
          rs76191297
          Gene
          PRMT7 SLC7A6 SLC7A6OS
          Gene Name
          protein arginine methyltransferase 7
          solute carrier family 7 member 6
          solute carrier family 7 member 6 opposite strand
          Set Membership:
          -
          Chromosome Location:
          Chr.16: 68309697 - 68309697 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          ACCTCAAACTTGATATGCTATCCAG[G/A]ACTATTCCTTTAACCTCTCTTTGAT

          Assay ID C_102099671_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610087 MIM: 605641

          Literature Links:

          PRMT7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.02)
          (0.98)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          PRMT7 - protein arginine methyltransferase 7
          There are no transcripts associated with this gene.
          SLC7A6 - solute carrier family 7 member 6
          There are no transcripts associated with this gene.
          SLC7A6OS - solute carrier family 7 member 6 opposite strand
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_032178.2 Intron NP_115554.2
          XM_011523372.2 Intron XP_011521674.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s)

          hematopoietic progenitor cell differentiation
          protein transport

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Commander Plus Icon Minus Icon
          • Statut des commandes
          • Assistance commandes
          • Commande rapide
          • Centre d’approvisionnement
          • Approvisionnement en ligne
          Assistance Plus Icon Minus Icon
          • Aide et assistance
          • Contactez-nous
          • Centres d’assistance technique
          • Documents et certificats
          • Signaler un problème sur le site
          Ressources Plus Icon Minus Icon
          • Centres d’apprentissage
          • Promotions
          • Événements et séminaires en ligne
          • Réseaux sociaux
          À propos de Thermo Fisher Plus Icon Minus Icon
          • À propos de nous À propos de nous
          • Emplois Emplois
          • Investisseurs Investisseurs
          • Actualités Actualités
          • Responsabilité sociale Responsabilité sociale
          • Marques commerciales
          • Politiques et notices d’information
          Notre portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          France flag icon
          France

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline