Search
LOADING 
- SNP ID:
- rs114546436
- Gene
-
C22orf15CHCHD10MMP11VPREB3 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.22: 23764357 - 23764357 on Build GRCh38
- Polymorphism:
- A/T, Transversion substitution
- Context Sequence [VIC/FAM]:
GGGCCCAGACCATGGGCAACTCCCT[A/T]CTGAAGGAGCGAGCCATATATGTCC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615903
MIM: 185261
MIM: 605017
|
||||||||||||||||||||||||||||||||||||||
Literature Links: |
C22orf15 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
| C22orf15 - chromosome 22 open reading frame 15 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_182520.2 | 1287 | Silent Mutation | CTA,CTT | L,L 70 | NP_872326.2 | |
| XM_011529907.2 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_011528209.1 | |
| XM_011529908.2 | 1287 | Silent Mutation | CTA,CTT | L,L 70 | XP_011528210.2 | |
| XM_011529912.2 | 1287 | Intron | XP_011528214.1 | |||
| XM_017028602.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884091.1 | |
| XM_017028603.1 | 1287 | Silent Mutation | CTA,CTT | L,L 133 | XP_016884092.1 | |
| XM_017028604.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884093.1 | |
| XM_017028605.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884094.1 | |
| XM_017028606.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884095.1 | |
| XM_017028607.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884096.1 | |
| XM_017028608.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884097.1 | |
| XM_017028609.1 | 1287 | Silent Mutation | CTA,CTT | L,L 77 | XP_016884098.1 | |
| XM_017028610.1 | 1287 | Silent Mutation | CTA,CTT | L,L 70 | XP_016884099.1 | |
| XM_017028611.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884100.1 | |
| XM_017028612.1 | 1287 | Silent Mutation | CTA,CTT | L,L 70 | XP_016884101.1 | |
| XM_017028613.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884102.1 | |
| XM_017028614.1 | 1287 | Silent Mutation | CTA,CTT | L,L 140 | XP_016884103.1 | |
| XM_017028615.1 | 1287 | Silent Mutation | CTA,CTT | L,L 70 | XP_016884104.1 | |
| XM_017028616.1 | 1287 | Silent Mutation | CTA,CTT | L,L 70 | XP_016884105.1 | |
| XM_017028617.1 | 1287 | Silent Mutation | CTA,CTT | L,L 70 | XP_016884106.1 | |
| XM_017028618.1 | 1287 | Silent Mutation | CTA,CTT | L,L 77 | XP_016884107.1 | |
| CHCHD10 - coiled-coil-helix-coiled-coil-helix domain containing 10 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MMP11 - matrix metallopeptidase 11 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| VPREB3 - pre-B lymphocyte 3 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top