Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCTGCCCGCGCACTCAGCTCCTC[A/G]GAGAGAGGGGGGAAGTCGTAAATGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600838 MIM: 610271 MIM: 604011 | ||||||||||||||||||||
Literature Links: |
FOXN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FOXN1 - forkhead box N1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGS - phosphatidylinositol glycan anchor biosynthesis class S | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UNC119 - unc-119 lipid binding chaperone | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005148.3 | 671 | Silent Mutation | TCC,TCT | S,S 200 | NP_005139.1 | |
NM_054035.2 | 671 | Silent Mutation | TCC,TCT | S,S 200 | NP_473376.1 | |
XM_011525459.2 | 671 | Intron | XP_011523761.1 | |||
XM_017025289.1 | 671 | Silent Mutation | TCC,TCT | S,S 105 | XP_016880778.1 |