Hamburger Menu Button
Thermo Fisher Scientific Logo
Se connecter
Vous n’avez pas de compte? Créer votre compte
  • Produits
    • Anticorps
    • Oligos, amorces, sondes et gènes
    • Réactions PCR en temps réel Taqman
    • Milieux de culture cellulaire
    • Produits chimiques
    • Colonnes et cartouches de chromatographie
    • Équipement de laboratoire
    • Consommables en plastique et fournitures de laboratoire
    • Microplaques
    • Produits plus écologiques
    • Afficher toutes les catégories de produits
  • Applications
    • Bioprocédés
    • Culture cellulaire et transfection
    • Thérapie cellulaire et génétique
    • Chromatographie
    • Tests moléculaires
    • Solutions numériques
    • Extraction et analyse d’ADN et d’ARN
    • Spectroscopie, analyse élémentaire et isotopique
    • Voir toutes les applications et techniques
  • Services
    • Services CDMO et CRO à 360°
    • Services CDMO
    • Services CRO
    • Services personnalisés
    • Services financiers et leasing
    • Services pour les instruments
    • Informatique de laboratoire
    • Offres commerciales et OEM
    • Services de formation
    • Unity Lab Services
    • Voir tous les services
  • Aide et assistance
    • S’inscrire et créer un compte
    • Comment commander
    • Assistance instruments
    • Centres d’assistance technique
    • Centres d’apprentissage
    • Consultez toutes les rubriques d'aide et d'assistance
  • Populaire
    • TaqMan Real-Time PCR Assays
      Reaction PCR en temps réel TaqMan
    • Antibodies
      Anticorps
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt - Synthèse Gène
    • Cell Culture Plastics
      Plastiques culture cellulaire
  • Nos clients
    • Biotechnologie
    • Industrie biopharmaceutique
    • CDMO
    • Diagnostics de laboratoire
    • Sciences industrielles et appliquées associées
  • Promotions
  • Contactez-nous
  • Commande rapide
  • Suivi et statut de la commande
  • Documents et certificats
Thermo Fisher Scientific Logo

Search

Rechercher
Search button
          • Statut des commandes
          • Commande rapide
          • Promos
          • Se connecter
            Se connecter
            Vous n’avez pas de compte? Créer votre compte
            • Mon compte
            • Commandes
            • Connect: lab, données, apps
            • Produits personnalisés et projets
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2986231_1_
          See other ATP5L2 GT Assays ›
          SNP ID:
          rs916321
          Gene
          ATP5L2 CYB5R3
          Gene Name
          ATP synthase, H+ transporting, mitochondrial Fo complex subunit G2
          cytochrome b5 reductase 3
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.22: 42645385 - 42645385 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AGAGCCCAGACTCCTGGATGAGGGC[A/G]CGGCACAGCCTGTCCTGTTTGTCAG

          Assay ID C___2986231_1_
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 613213

          Literature Links:

          ATP5L2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.30)
          (0.70)
          Caucasian
          A (0.39)
          (0.61)
          CEPH (CEU)
          A (0.36)
          (0.64)
          EAS
          A (0.27)
          (0.73)
          African American
          A (0.13)
          (0.87)
          YRI (Yoruba)
          A (0.18)
          (0.82)
          SAS
          A (0.41)
          (0.59)
          Chinese - Not Available JPT (Japanese)
          A (0.33)
          (0.67)
          AFR
          A (0.13)
          (0.87)
          Japanese - Not Available CHB (Han Chinese)
          A (0.34)
          (0.66)
          EUR
          A (0.36)
          (0.64)
          AMR
          A (0.42)
          (0.58)
          ATP5L2 - ATP synthase, H+ transporting, mitochondrial Fo complex subunit G2
          There are no transcripts associated with this gene.
          CYB5R3 - cytochrome b5 reductase 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000398.6 Intron NP_000389.1
          NM_001129819.2 Intron NP_001123291.1
          NM_001171660.1 Intron NP_001165131.1
          NM_001171661.1 Intron NP_001165132.1
          NM_007326.4 Intron NP_015565.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          reductase

          Gene Ontology Categories:

          Function(s) Process(es)

          cholesterol biosynthetic process
          blood circulation
          L-ascorbic acid metabolic process
          oxidation-reduction process
          cytochrome-b5 reductase activity, acting on NAD(P)H
          AMP binding
          ADP binding
          flavin adenine dinucleotide binding
          NAD binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Commander Plus Icon Minus Icon
          • Statut des commandes
          • Assistance commandes
          • Commande rapide
          • Centre d’approvisionnement
          • Approvisionnement en ligne
          Assistance Plus Icon Minus Icon
          • Aide et assistance
          • Contactez-nous
          • Centres d’assistance technique
          • Documents et certificats
          • Signaler un problème sur le site
          Ressources Plus Icon Minus Icon
          • Centres d’apprentissage
          • Promotions
          • Événements et séminaires en ligne
          • Réseaux sociaux
          À propos de Thermo Fisher Plus Icon Minus Icon
          • À propos de nous À propos de nous
          • Emplois Emplois
          • Investisseurs Investisseurs
          • Actualités Actualités
          • Responsabilité sociale Responsabilité sociale
          • Marques commerciales
          • Politiques et notices d’information
          Notre portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          France flag icon
          France

          Your items have has been added!


          Host server : magellan-search-green-6b469b8bb7-lcddp:80/100.66.76.150:80.
          git-commit: a334af76dff23450325448aedefe62379591458a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.48.1-2026.04.16-1.0