Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Hs03303027_pri
          Assay Name:
          hsa-mir-200b
          Stem-loop ID:
          hsa-mir-200b
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.1: 1167104 - 1167198 [+] on Build GRCh38
          Stem-loop Location:
          Chr.1: 1167104 - 1167198 [+] on Build GRCh38
          Mature miRNA ID:
          hsa-miR-200b-3p hsa-miR-200b-5p
          Species:
          Human
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Hs03303027_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          74

          Chromosome Location:

          Chr. 1 - 1166801 - 1166801 [-] on 1166801 Build GRCh38

          Species:

          Human

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-200b-3p MIMAT0000318
          Human hsa-miR-200b-5p MIMAT0004571

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-200b
          Stem-loop Accession # MI0000342
          Stem-loop Sequence
          CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG
          Chromosome Location Chr. 1 - 1167104 - 1167198 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0000318
          miRBase ID: hsa-miR-200b-3p
          Mature miRNA Sequence: UAAUACUGCCUGGUAAUGAUGA
          Chromosome Location: Chr. 1 - 1167104 - 1167198 [+] on Build GRCh38

          miRBase Accession #: MIMAT0004571
          miRBase ID: hsa-miR-200b-5p
          Mature miRNA Sequence: CAUCUUACUGGGCAGCAUUGGA
          Chromosome Location: Chr. 1 - 1167104 - 1167198 [+] on Build GRCh38

          Gene Family ID MIPF0000019, mir-8
          Distance to Amplicon 257 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM10492
          Ambion® Pre-miR™ miRNA Precursor : PM10492
          TaqMan™ MicroRNA Assay : 002251
          mirVana® miRNA inhibitor : MH10492
          mirVana® miRNA mimic : MC10492
          TaqMan™ Advanced miRNA Assay : 477963_mir
          TaqMan™ Advanced miRNA Assay : mmu482918_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM12857
          Ambion® Pre-miR™ miRNA Precursor : PM12857
          TaqMan™ MicroRNA Assay : 002274
          mirVana® miRNA inhibitor : MH12857
          mirVana® miRNA mimic : MC12857
          TaqMan™ Advanced miRNA Assay : 478753_mir
          TaqMan™ Advanced miRNA Assay : mmu478753_mir
          TaqMan™ Advanced miRNA Assay : rno478753_mir

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline