Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Instrument Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • Our Instagram
      Our Instagram
    • Our Facebook
      Our Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Rn03465090_pri
          Assay Name:
          rno-mir-181b-1
          Stem-loop ID:
          rno-mir-181b-1
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.13: 54952903 - 54953012 [+] on Build Rnor_6.0
          Stem-loop Location:
          Chr.13: 54952903 - 54953012 [+] on Build Rnor_6.0
          Mature miRNA ID:
          rno-miR-181b-5p rno-miR-181b-1-3p
          Species:
          Rat
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Rn03465090_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          65

          Chromosome Location:

          Chr. 13 - 54953257 - 54953257 [-] on 54953257 Build Rnor_6.0

          Species:

          Rat

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Rat rno-miR-181b-5p MIMAT0000859
          Rat rno-miR-181b-1-3p MIMAT0017139

          Stem-loop Details



          Rat

          Stem-loop ID rno-mir-181b-1
          Stem-loop Accession # MI0000926
          Stem-loop Sequence
          CCUGUGCAGAGAUGAUGUUUACAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUGAACUGUGUAGAAAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCGCUU
          Chromosome Location Chr. 13 - 54952903 - 54953012 [+] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0000859
          miRBase ID: rno-miR-181b-5p
          Mature miRNA Sequence: AACAUUCAUUGCUGUCGGUGGGU
          Chromosome Location: Chr. 13 - 54952903 - 54953012 [+] on Build Rnor_6.0

          miRBase Accession #: MIMAT0017139
          miRBase ID: rno-miR-181b-1-3p
          Mature miRNA Sequence: CUCACUGAACAAUGAAUGCAA
          Chromosome Location: Chr. 13 - 54952903 - 54953012 [+] on Build Rnor_6.0

          Gene Family ID MIPF0000007, mir-181
          Distance to Amplicon 213 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM12442
          Ambion® Pre-miR™ miRNA Precursor : PM12442
          mirVana® miRNA inhibitor : MH12442
          mirVana® miRNA mimic : MC12442
          TaqMan™ Advanced miRNA Assay : rno478583_mir
          TaqMan™ Advanced miRNA Assay : 478583_mir
          TaqMan™ Advanced miRNA Assay : mmu478583_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM20327
          Ambion® Pre-miR™ miRNA Precursor : PM20327
          TaqMan™ MicroRNA Assay : 462578_mat
          mirVana® miRNA inhibitor : MH20327
          mirVana® miRNA mimic : MC20327

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Find Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline