Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Rn03465114_pri
          Assay Name:
          rno-mir-3570
          Stem-loop ID:
          rno-mir-181a-1 rno-mir-3570
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.13: 54952742 - 54952841 [+] on Build Rnor_6.0
          Stem-loop Location:
          Chr.13: 54952742 - 54952841 [+] on Build Rnor_6.0 Chr.13: 54952723 - 54952839 [-] on Build Rnor_6.0
          Mature miRNA ID:
          rno-miR-181a-5p rno-miR-181a-1-3p rno-miR-3570
          Species:
          Rat
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Rn03465114_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          60

          Chromosome Location:

          Chr. 13 - 54952595 - 54952595 [-] on 54952595 Build Rnor_6.0

          Species:

          Rat

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Rat rno-miR-181a-5p MIMAT0000858
          Rat rno-miR-181a-1-3p MIMAT0000884
          Rat rno-miR-3570 MIMAT0017850

          Stem-loop Details



          Rat

          Stem-loop ID rno-mir-181a-1
          Stem-loop Accession # MI0000953
          Stem-loop Sequence
          AGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUCAAAUAAAAACCAUCGACCGUUGAUUGUACCCUAUAGCUAACCAUUAUCUACUCC
          Chromosome Location Chr. 13 - 54952742 - 54952841 [+] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0000858
          miRBase ID: rno-miR-181a-5p
          Mature miRNA Sequence: AACAUUCAACGCUGUCGGUGAGU
          Chromosome Location: Chr. 13 - 54952742 - 54952841 [+] on Build Rnor_6.0

          miRBase Accession #: MIMAT0000884
          miRBase ID: rno-miR-181a-1-3p
          Mature miRNA Sequence: ACCAUCGACCGUUGAUUGUACC
          Chromosome Location: Chr. 13 - 54952742 - 54952841 [+] on Build Rnor_6.0

          Gene Family ID MIPF0000007, mir-181
          Distance to Amplicon 122 bases
          Stem-loop ID rno-mir-3570
          Stem-loop Accession # MI0015438
          Stem-loop Sequence
          AGUAGAUAAUGGUUAGCUAUAGGGUACAAUCAACGGUCGAUGGUUUUUAUUUGAAUUCCAAACUCACCGACAGCGUUGAAUGUUCACUGAAGCAACCUGUGAGCCAGAGGUGUGCUG
          Chromosome Location Chr. 13 - 54952723 - 54952839 [-] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0017850
          miRBase ID: rno-miR-3570
          Mature miRNA Sequence: GGUACAAUCAACGGUCGAUGGU
          Chromosome Location: Chr. 13 - 54952723 - 54952839 [-] on Build Rnor_6.0

          Gene Family ID
          Distance to Amplicon 103 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM10421
          Ambion® Pre-miR™ miRNA Precursor : PM10421
          TaqMan™ MicroRNA Assay : 000480
          mirVana® miRNA inhibitor : MH10421
          mirVana® miRNA mimic : MC10421
          TaqMan™ Advanced miRNA Assay : 477857_mir
          TaqMan™ Advanced miRNA Assay : rno481485_mir
          TaqMan™ Advanced miRNA Assay : mmu481485_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM19303
          Ambion® Pre-miR™ miRNA Precursor : PM19303
          TaqMan™ MicroRNA Assay : 463040_mat
          mirVana® miRNA inhibitor : MH19303
          mirVana® miRNA mimic : MC19303
          TaqMan™ Advanced miRNA Assay : rno481107_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM10381
          Ambion® Pre-miR™ miRNA Precursor : PM10381
          TaqMan™ MicroRNA Assay : 000516
          mirVana® miRNA inhibitor : MH10381
          mirVana® miRNA mimic : MC10381
          TaqMan™ Advanced miRNA Assay : 479405_mir


          miRBase Alias:

          Rat: rno-mir-181a-1 (v21)

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline