Hamburger Menu Button
Thermo Fisher Scientific Logo
登入
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Tubes
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Clinical Genomics
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO 和 CRO 服務
    • CDMO 服務
    • 臨床試驗 CRO 服務
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Register for an Account
    • How to Order
    • Instrument Support
    • Technical Support Centers
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • 快速訂購
          • 登入
            登入
            Don't have an account ? Create Account
            • 帳戶
            • 訂單
            • 訂製產品與專案
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › mmu482942_mir

          Specificity testing was performed using mouse anti-targets.

          Assay Name: mmu-miR-135a-2-3p
          Stem-loop Accession Number: MI0000715
          miRBase Version: v22.1
          Chromosome Location: Chr.10: 92072086 - 92072185 [-] on Build GRCm38
          Mature miRNA Sequence: UGUAGGGAUGGAAGCCAUGAA
          Species: Mouse, Dasypus novemcinctus, Guinea pig, Rabbit
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID mmu482942_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000028, mir-135

          Mature miRNA Sequence:

          UGUAGGGAUGGAAGCCAUGAA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-135a-2-3p MIMAT0017064
          Dasypus novemcinctus dno-miR-135a-2-3p MIMAT0047641
          Guinea pig cpo-miR-135a-2-3p MIMAT0046994
          Rabbit ocu-miR-135a-2-3p MIMAT0048229

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-135a-2
          Stem-loop Accession # MI0000715
          Stem-loop Sequence
          AGAUAAAUUCACUCUAGUGCUUUAUGGCUUUUUAUUCCUAUGUGAUCGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAAAUACAUUGUGAAAAUUCA
          Chromosome Location Chr. 10 - 92072086 - 92072185 [-] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0017064
          miRBase ID: mmu-miR-135a-2-3p
          Mature miRNA Sequence: UGUAGGGAUGGAAGCCAUGAA
          Chromosome Location: Chr. 10 - 92072086 - 92072185 [-] on Build GRCm38

          Dasypus novemcinctus

          Stem-loop ID dno-mir-135a-2
          Stem-loop Accession # MI0038982
          Stem-loop Sequence
          UAUGGCUUUUUAUUCCUAUGUGAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0047641
          miRBase ID: dno-miR-135a-2-3p
          Mature miRNA Sequence: UGUAGGGAUGGAAGCCAUGAA
          Chromosome Location: NA

          Guinea pig

          Stem-loop ID cpo-mir-135a-2
          Stem-loop Accession # MI0038641
          Stem-loop Sequence
          UAUGGCUUUUUAUUCCUAUGUGAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0046994
          miRBase ID: cpo-miR-135a-2-3p
          Mature miRNA Sequence: UGUAGGGAUGGAAGCCAUGAA
          Chromosome Location: NA

          Rabbit

          Stem-loop ID ocu-mir-135a-2
          Stem-loop Accession # MI0039291
          Stem-loop Sequence
          UAUGGCUUUUUAUUCCUAUGUGAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0048229
          miRBase ID: ocu-miR-135a-2-3p
          Mature miRNA Sequence: UGUAGGGAUGGAAGCCAUGAA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm03307210_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM19694
          Ambion® Pre-miR™ miRNA Precursor : PM19694
          TaqMan™ MicroRNA Assay : 462760_mat
          mirVana® miRNA inhibitor : MH19694
          mirVana® miRNA mimic : MC19694

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Hong Kong flag icon
          Hong Kong

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline