Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 001988
          Assay Name: hsa-miR-598
          miRBase Accession Number: MI0003610
          miRBase Version: v22.1
          Chromosome Location: Chr.8: 11035206 - 11035302 [-] on Build GRCh38
          Mature miRNA Sequence: UACGUCAUCGUUGUCAUCGUCA
          Species: Human, Gorilla gorilla, Horse, Pan troglodytes, Pongo pygmaeus, Rhesus monkey
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 001988
          Size
          Availability Inventoried
          Catalog # 4427975
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000393, mir-598

          Mature miRNA Sequence:

          UACGUCAUCGUUGUCAUCGUCA

          Mature miRNA Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-598-3p MIMAT0003266
          Gorilla gorilla ggo-miR-598 MIMAT0024089
          Horse eca-miR-598 MIMAT0012922
          Pan troglodytes ptr-miR-598 MIMAT0008267
          Pongo pygmaeus ppy-miR-598 MIMAT0016040
          Rhesus monkey mml-miR-598-3p MIMAT0006455

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-598
          Stem-loop Accession # MI0003610
          Stem-loop Sequence
          GCUUGAUGAUGCUGCUGAUGCUGGCGGUGAUCCCGAUGGUGUGAGCUGGAAAUGGGGUGCUACGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCCGAG
          Chromosome Location Chr. 8 - 11035206 - 11035302 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0003266
          miRBase ID: hsa-miR-598-3p
          Mature miRNA Sequence: UACGUCAUCGUUGUCAUCGUCA
          Chromosome Location: Chr. 8 - 11035206 - 11035302 [-] on Build GRCh38

          Gorilla gorilla

          Stem-loop ID ggo-mir-598
          Stem-loop Accession # MI0020636
          Stem-loop Sequence
          CAGGAAGAUGGCUUGAUGAUGCUGCUGAUGCUGGCGGUGAUCCCGAUGGUGUGAGCUGGAAAUGGGGUGCUACGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCCGAGCAGCC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0024089
          miRBase ID: ggo-miR-598
          Mature miRNA Sequence: UACGUCAUCGUUGUCAUCGUCA
          Chromosome Location: NA

          Horse

          Stem-loop ID eca-mir-598
          Stem-loop Accession # MI0012678
          Stem-loop Sequence
          UGAUGCUGGCAGUGAUGCCGAUGGUGCGGGCUGGAAAUGGGGUGCUACGUCAUCGUUGUCAUCGUCAUCAUCA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0012922
          miRBase ID: eca-miR-598
          Mature miRNA Sequence: UACGUCAUCGUUGUCAUCGUCA
          Chromosome Location: NA

          Pan troglodytes

          Stem-loop ID ptr-mir-598
          Stem-loop Accession # MI0008804
          Stem-loop Sequence
          GCUUGAUGAUGCUGCUGAUGCUGGCGGUGAUCCCGAUGGUGUGAGCUGGAAAUGGGGUGCUACGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCCGA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0008267
          miRBase ID: ptr-miR-598
          Mature miRNA Sequence: UACGUCAUCGUUGUCAUCGUCA
          Chromosome Location: NA

          Pongo pygmaeus

          Stem-loop ID ppy-mir-598
          Stem-loop Accession # MI0015084
          Stem-loop Sequence
          GCUUGAUGAUGCUGCUGAUGCUGGCGGUGAUCCCGAUGGUGUGAGCUGGAAAUGGGGUGCUACGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCCGAG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0016040
          miRBase ID: ppy-miR-598
          Mature miRNA Sequence: UACGUCAUCGUUGUCAUCGUCA
          Chromosome Location: NA

          Rhesus monkey

          Stem-loop ID mml-mir-598
          Stem-loop Accession # MI0007859
          Stem-loop Sequence
          GCUUGAUGAUGCUGCUGAUGCUGGCGGUGAUCCCGAUGGUGUGAGCUGGAAAUGGGGUGCUACGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCCGAG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0006455
          miRBase ID: mml-miR-598-3p
          Mature miRNA Sequence: UACGUCAUCGUUGUCAUCGUCA
          Chromosome Location: NA


          Back To Top

          More Information


          Associated Megaplex™ RT Primer Pool:

          Megaplex™ RT Primers, Human Pool A




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03304528_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM11417
          Ambion® Pre-miR™ miRNA Precursor : PM11417
          mirVana® miRNA inhibitor : MH11417
          mirVana® miRNA mimic : MC11417
          TaqMan™ Advanced miRNA Assay : 478172_mir
          FGMIR : TaqManTM Human MicroRNA Array A
          MIRNA : TaqMan® Array Human MicroRNA A+B Cards Set v3.0
          miRNA Card : TaqMan® Human MicroRNA A Cards v2.0
          MIRNA : TaqMan® Array Human MicroRNA A Cards v2.0
          FGMIR : QS TaqMan OpenArray Rod miRNA Plate
          miRNA Pool : Megaplex™ RT Primers, Human Pool A
          MIRNA : TaqMan® OpenArray Rodent MicroRNA Panel


          miRBase Alias:

          Human: hsa-miR-598 (v19)
          Macaca mulatta: mml-miR-598 (v19)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline