Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Hs03295169_pri
          Assay Name:
          hsa-mir-34c
          Stem-loop ID:
          hsa-mir-34c
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.11: 111513439 - 111513515 [+] on Build GRCh38
          Stem-loop Location:
          Chr.11: 111513439 - 111513515 [+] on Build GRCh38
          Mature miRNA ID:
          hsa-miR-34c-3p hsa-miR-34c-5p
          Species:
          Human
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Hs03295169_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          97

          Chromosome Location:

          Chr. 11 - 111513940 - 111513940 [-] on 111513940 Build GRCh38

          Species:

          Human

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-34c-3p MIMAT0004677
          Human hsa-miR-34c-5p MIMAT0000686

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-34c
          Stem-loop Accession # MI0000743
          Stem-loop Sequence
          AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU
          Chromosome Location Chr. 11 - 111513439 - 111513515 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004677
          miRBase ID: hsa-miR-34c-3p
          Mature miRNA Sequence: AAUCACUAACCACACGGCCAGG
          Chromosome Location: Chr. 11 - 111513439 - 111513515 [+] on Build GRCh38

          miRBase Accession #: MIMAT0000686
          miRBase ID: hsa-miR-34c-5p
          Mature miRNA Sequence: AGGCAGUGUAGUUAGCUGAUUGC
          Chromosome Location: Chr. 11 - 111513439 - 111513515 [+] on Build GRCh38

          Gene Family ID MIPF0000039, mir-34
          Distance to Amplicon 372 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM12342
          Ambion® Pre-miR™ miRNA Precursor : PM12342
          TaqMan™ MicroRNA Assay : 241009_mat
          mirVana® miRNA inhibitor : MH12342
          mirVana® miRNA mimic : MC12342
          TaqMan™ Advanced miRNA Assay : 478051_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM11039
          Ambion® Pre-miR™ miRNA Precursor : PM11039
          TaqMan™ MicroRNA Assay : 000428
          mirVana® miRNA inhibitor : MH11039
          mirVana® miRNA mimic : MC11039
          TaqMan™ Advanced miRNA Assay : 478052_mir

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline