Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__27104892_10
          See other CYP2C9 GT Assays ›
          SNP ID:
          rs1057910
          Gene
          CYP2C9
          Gene Name
          cytochrome P450 family 2 subfamily C member 9
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.10: 94981296 - 94981296 on Build GRCh38
          Polymorphism:
          C/A, Transversion substitution
          Context Sequence [VIC/FAM]:

          TGTGGTGCACGAGGTCCAGAGATAC[C/A]TTGACCTTCTCCCCACCAGCCTGCC

          Assay ID C__27104892_10
          Size VIC-FAM | 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601130

          Literature Links:

          CYP2C9 PubMed Links

          Allele Nomenclature:

          CYP2C9*18,c.1075A>C CYP2C9*18,g.42614A>C CYP2C9*3A,c.1075A>C CYP2C9*3A,g.42614A>C CYP2C9*3B,c.1075A>C CYP2C9*3B,g.42614A>C

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.05)
          (0.95)
          Caucasian
          C (0.10)
          (0.90)
          CEPH (CEU)
          C (0.06)
          (0.94)
          EAS
          C (0.03)
          (0.97)
          African American
          C (0.02)
          (0.98)
          YRI (Yoruba) - Not Available
          SAS
          C (0.11)
          (0.89)
          Japanese
          C (0.06)
          (0.94)
          JPT (Japanese)
          C (0.02)
          (0.98)
          AFR
          C (0.00)
          (1.00)
          Chinese
          C (0.01)
          (0.99)
          CHB (Han Chinese)
          C (0.04)
          (0.96)
          EUR
          C (0.07)
          (0.93)
          AMR
          C (0.04)
          (0.96)
          CYP2C9 - cytochrome P450 family 2 subfamily C member 9
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000771.3 1100 Missense Mutation ATT,CTT I,L 359 NP_000762.2
          XM_017015758.1 1100 Missense Mutation ATT,CTT I,L 359 XP_016871247.1

          Back To Top

          More Information


          Important Information

          Assay C__27104892_10 detects the highly polymorphic CYP2C9*3,*18 c.1075A>C SNP, which is adjacent to the rare CYP2C9*4 c. 1076T>C SNP that is detected by assay C__30634131_20. These two SNP assays can be used to detect the 3 possible haplotypes described for this locus (www.pharmvar.org/gene/CYP2C9; minor alleles 1076C and 1075C do not occur together in a haplotype). Run both assays separately on the same samples and analyze data as described in the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 5 section 'TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets'.
          Assay C__30634131_20 interrogates the CYP2C9*4 c. 1076T>C SNP (rs56165452).

          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          oxidoreductase oxygenase metabolite interconversion enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          xenobiotic metabolic process
          steroid metabolic process
          monoterpenoid metabolic process
          drug metabolic process
          epoxygenase P450 pathway
          urea metabolic process
          monocarboxylic acid metabolic process
          drug catabolic process
          exogenous drug catabolic process
          cellular amide metabolic process
          oxidation-reduction process
          oxidative demethylation
          omega-hydroxylase P450 pathway
          cholesterol 25-hydroxylase activity
          monooxygenase activity
          iron ion binding
          drug binding
          arachidonic acid epoxygenase activity
          steroid hydroxylase activity
          oxidoreductase activity
          (S)-limonene 6-monooxygenase activity
          (S)-limonene 7-monooxygenase activity
          oxygen binding
          heme binding
          caffeine oxidase activity
          (R)-limonene 6-monooxygenase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-744bc48644-fvx7n:80/100.66.78.247:80.
          git-commit: 747bde55a712f6f97bf7760408d445eefba4e16f
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.48.0-Offline