Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1129864_10
          See other PPARG GT Assays ›
          SNP ID:
          rs1801282
          Gene
          PPARG
          Gene Name
          peroxisome proliferator activated receptor gamma
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.3: 12351626 - 12351626 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AACTCTGGGAGATTCTCCTATTGAC[C/G]CAGAAAGCGATTCCTTCACTGATAC

          Assay ID C___1129864_10
          Size VIC-FAM | 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601487

          Literature Links:

          PPARG PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.07)
          (0.93)
          Caucasian
          G (0.18)
          (0.82)
          CEPH (CEU)
          G (0.10)
          (0.90)
          EAS
          G (0.03)
          (0.97)
          African American
          G (0.02)
          (0.98)
          YRI (Yoruba) - Not Available
          SAS
          G (0.12)
          (0.88)
          Japanese
          G (0.03)
          (0.97)
          JPT (Japanese)
          G (0.04)
          (0.96)
          AFR
          G (0.01)
          (0.99)
          Chinese
          G (0.01)
          (0.99)
          CHB (Han Chinese)
          G (0.02)
          (0.98)
          EUR
          G (0.12)
          (0.88)
          AMR
          G (0.12)
          (0.88)
          PPARG - peroxisome proliferator activated receptor gamma
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_005037.5 2153 Intron NP_005028.4
          NM_015869.4 2153 Missense Mutation CCA,GCA P,A 12 NP_056953.2
          NM_138711.3 2153 Intron NP_619725.2
          NM_138712.3 2153 Intron NP_619726.2
          XM_011533841.2 2153 Intron XP_011532143.1
          XM_011533842.2 2153 Missense Mutation CCA,GCA P,A 12 XP_011532144.1
          XM_011533843.2 2153 Missense Mutation CCA,GCA P,A 12 XP_011532145.1
          XM_011533844.1 2153 Intron XP_011532146.1

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          C4 zinc finger nuclear receptor DNA-binding transcription factor zinc finger transcription factor gene-specific transcriptional regulator

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          placenta development
          negative regulation of acute inflammatory response
          transcription initiation from RNA polymerase II promoter
          lipid metabolic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          signal transduction
          G-protein coupled receptor signaling pathway
          heart development
          response to nutrient
          regulation of blood pressure
          response to cold
          response to mechanical stimulus
          macrophage derived foam cell differentiation
          negative regulation of macrophage derived foam cell differentiation
          negative regulation of receptor biosynthetic process
          negative regulation of cholesterol storage
          negative regulation of sequestering of triglyceride
          long-chain fatty acid transport
          fatty acid oxidation
          monocyte differentiation
          negative regulation of cell growth
          epithelial cell differentiation
          response to caffeine
          organ regeneration
          response to retinoic acid
          cellular response to insulin stimulus
          negative regulation of collagen biosynthetic process
          response to vitamin A
          response to lipid
          peroxisome proliferator activated receptor signaling pathway
          response to immobilization stress
          response to diuretic
          glucose homeostasis
          response to starvation
          regulation of circadian rhythm
          lipoprotein transport
          steroid hormone mediated signaling pathway
          response to estrogen
          innate immune response
          cell fate commitment
          positive regulation of fat cell differentiation
          low-density lipoprotein particle receptor biosynthetic process
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of fatty acid oxidation
          cell maturation
          rhythmic process
          negative regulation of smooth muscle cell proliferation
          positive regulation of oligodendrocyte differentiation
          white fat cell differentiation
          positive regulation of sequence-specific DNA binding transcription factor activity
          negative regulation of telomerase activity
          lipid homeostasis
          response to low-density lipoprotein particle
          positive regulation of phagocytosis, engulfment
          negative regulation of interferon-gamma-mediated signaling pathway
          regulation of cholesterol transporter activity
          regulation of transcription involved in cell fate commitment
          cellular response to retinoic acid
          cellular response to vitamin E
          cellular response to prostaglandin E stimulus
          cellular response to hyperoxia
          response to metformin
          negative regulation of pancreatic stellate cell proliferation
          core promoter sequence-specific DNA binding
          DNA binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          steroid hormone receptor activity
          RNA polymerase II transcription factor activity, ligand-activated sequence-specific DNA binding
          prostaglandin receptor activity
          protein binding
          transcription factor binding
          drug binding
          zinc ion binding
          enzyme binding
          protein phosphatase binding
          estrogen receptor binding
          ligand-dependent nuclear receptor transcription coactivator activity
          activating transcription factor binding
          identical protein binding
          sequence-specific DNA binding
          transcription regulatory region DNA binding
          retinoid X receptor binding
          arachidonic acid binding
          alpha-actinin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline