Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1202883_20
          See other C1ORF167 GT Assays ›
          SNP ID:
          rs1801133
          Gene
          C1orf167 CLCN6 MTHFR
          Gene Name
          chromosome 1 open reading frame 167
          chloride voltage-gated channel 6
          methylenetetrahydrofolate reductase (NAD(P)H)
          Set Membership:
          > HapMap > JSNP
          Chromosome Location:
          Chr.1: 11796321 - 11796321 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GAAAAGCTGCGTGATGATGAAATCG[G/A]CTCCCGCAGACACCTTCTCCTTCAA

          Assay ID C___1202883_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          102 submissions

          Phenotype:

          MIM: 602726 MIM: 607093

          Literature Links:

          C1orf167 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.25)
          (0.75)
          Caucasian - Not Available CEPH (CEU)
          T (0.31)
          (0.69)
          EAS
          T (0.30)
          (0.70)
          African American - Not Available YRI (Yoruba)
          T (0.09)
          (0.91)
          SAS
          T (0.12)
          (0.88)
          Chinese - Not Available JPT (Japanese)
          T (0.36)
          (0.64)
          AFR
          T (0.09)
          (0.91)
          Japanese - Not Available CHB (Han Chinese)
          C (0.49)
          (0.51)
          EUR
          T (0.37)
          (0.63)
          AMR
          T (0.47)
          (0.53)
          C1orf167 - chromosome 1 open reading frame 167
          There are no transcripts associated with this gene.
          CLCN6 - chloride voltage-gated channel 6
          There are no transcripts associated with this gene.
          MTHFR - methylenetetrahydrofolate reductase (NAD(P)H)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_005957.4 1731 Missense Mutation GCC,GTC A,V 222 NP_005948.3
          XM_005263458.3 1731 Missense Mutation GCC,GTC A,V 263 XP_005263515.1
          XM_005263460.4 1731 Missense Mutation GCC,GTC A,V 222 XP_005263517.1
          XM_005263462.4 1731 Missense Mutation GCC,GTC A,V 222 XP_005263519.1
          XM_005263463.3 1731 Missense Mutation GCC,GTC A,V 140 XP_005263520.1
          XM_011541495.2 1731 Missense Mutation GCC,GTC A,V 262 XP_011539797.1
          XM_011541496.2 1731 Missense Mutation GCC,GTC A,V 263 XP_011539798.1
          XM_017001328.1 1731 Missense Mutation GCC,GTC A,V 263 XP_016856817.1

          Back To Top

          More Information


          Set Membership:

          HapMap JSNP

          Panther Classification:

          Molecular Function -

          reductase

          Gene Ontology Categories:

          Function(s) Process(es)

          response to hypoxia
          cellular amino acid metabolic process
          methionine metabolic process
          blood circulation
          regulation of histone methylation
          response to vitamin B2
          tetrahydrofolate interconversion
          response to drug
          response to amino acid
          S-adenosylmethionine metabolic process
          folic acid metabolic process
          homocysteine metabolic process
          response to folic acid
          oxidation-reduction process
          response to interleukin-1
          heterochromatin maintenance
          methylenetetrahydrofolate reductase (NAD(P)H) activity
          protein complex binding
          flavin adenine dinucleotide binding
          NADP binding
          modified amino acid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-6b469b8bb7-5xwv5:80/100.66.76.242:80.
          git-commit: a334af76dff23450325448aedefe62379591458a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.48.1-2026.04.16-1.0